ID: 1122299262

View in Genome Browser
Species Human (GRCh38)
Location 14:100722814-100722836
Sequence TCCCTGTGTTGAGGGCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122299262_1122299270 -4 Left 1122299262 14:100722814-100722836 CCTGTAAGCCCTCAACACAGGGA No data
Right 1122299270 14:100722833-100722855 GGGATGGTGGCTTCTTGGCGGGG No data
1122299262_1122299268 -6 Left 1122299262 14:100722814-100722836 CCTGTAAGCCCTCAACACAGGGA No data
Right 1122299268 14:100722831-100722853 CAGGGATGGTGGCTTCTTGGCGG No data
1122299262_1122299273 22 Left 1122299262 14:100722814-100722836 CCTGTAAGCCCTCAACACAGGGA No data
Right 1122299273 14:100722859-100722881 CCTCCTGCCCAGCTGTCTCCTGG No data
1122299262_1122299267 -9 Left 1122299262 14:100722814-100722836 CCTGTAAGCCCTCAACACAGGGA No data
Right 1122299267 14:100722828-100722850 ACACAGGGATGGTGGCTTCTTGG No data
1122299262_1122299271 -3 Left 1122299262 14:100722814-100722836 CCTGTAAGCCCTCAACACAGGGA No data
Right 1122299271 14:100722834-100722856 GGATGGTGGCTTCTTGGCGGGGG No data
1122299262_1122299269 -5 Left 1122299262 14:100722814-100722836 CCTGTAAGCCCTCAACACAGGGA No data
Right 1122299269 14:100722832-100722854 AGGGATGGTGGCTTCTTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122299262 Original CRISPR TCCCTGTGTTGAGGGCTTAC AGG (reversed) Intergenic
No off target data available for this crispr