ID: 1122300777

View in Genome Browser
Species Human (GRCh38)
Location 14:100729867-100729889
Sequence GTCCCCAACATTAGTAAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122300765_1122300777 19 Left 1122300765 14:100729825-100729847 CCCAGCTGTGTAGCAGCCTGCCC 0: 1
1: 0
2: 2
3: 20
4: 231
Right 1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG 0: 1
1: 0
2: 0
3: 2
4: 77
1122300766_1122300777 18 Left 1122300766 14:100729826-100729848 CCAGCTGTGTAGCAGCCTGCCCT 0: 1
1: 0
2: 3
3: 22
4: 251
Right 1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG 0: 1
1: 0
2: 0
3: 2
4: 77
1122300770_1122300777 -1 Left 1122300770 14:100729845-100729867 CCCTCAGGGCCCCTGTCCCTCAG 0: 1
1: 1
2: 5
3: 43
4: 364
Right 1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG 0: 1
1: 0
2: 0
3: 2
4: 77
1122300772_1122300777 -10 Left 1122300772 14:100729854-100729876 CCCCTGTCCCTCAGTCCCCAACA 0: 1
1: 0
2: 8
3: 80
4: 776
Right 1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG 0: 1
1: 0
2: 0
3: 2
4: 77
1122300771_1122300777 -2 Left 1122300771 14:100729846-100729868 CCTCAGGGCCCCTGTCCCTCAGT 0: 1
1: 0
2: 5
3: 36
4: 414
Right 1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG 0: 1
1: 0
2: 0
3: 2
4: 77
1122300769_1122300777 3 Left 1122300769 14:100729841-100729863 CCTGCCCTCAGGGCCCCTGTCCC 0: 1
1: 0
2: 6
3: 96
4: 874
Right 1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG 0: 1
1: 0
2: 0
3: 2
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122300777 Original CRISPR GTCCCCAACATTAGTAAAGA CGG Intronic
900687677 1:3958999-3959021 TTCCCCTAAATTAGTACAGATGG + Intergenic
905616204 1:39401903-39401925 CTCCTCAATATTAGAAAAGAAGG - Intronic
917860429 1:179138608-179138630 GGCCTCAACATTTGAAAAGATGG - Intronic
924316230 1:242800552-242800574 GTTACCAACATTAGTAGGGAAGG - Intergenic
924396782 1:243629480-243629502 GTCCCCAAAATAAGTAGATATGG + Intronic
1064509827 10:16077753-16077775 GTCCACAGTATTAGGAAAGATGG - Intergenic
1069182441 10:65378653-65378675 GTCCCCAAAATTTTAAAAGATGG + Intergenic
1077403654 11:2371744-2371766 GTCCCCATCATTAGTCATCAGGG - Intergenic
1083116934 11:60469956-60469978 TTCCCCAAAATTAGAAAAAAAGG + Exonic
1099366820 12:81775854-81775876 TGCTCCAAGATTAGTAAAGAAGG - Intergenic
1109826889 13:67733186-67733208 GTCAGCAACATTTGTAAATAAGG - Intergenic
1112822943 13:103357178-103357200 GTCCCCTTCAGTGGTAAAGAAGG + Intergenic
1114389932 14:22296284-22296306 TTCCCCAACCTTATTCAAGACGG - Intergenic
1115981452 14:39056301-39056323 TCCCACAACATTAGTAGAGAGGG + Intronic
1121691608 14:95881666-95881688 GTCCCCAACATCAGCTACGACGG - Intergenic
1122095541 14:99368141-99368163 GTCCACATCATTAGTCATGAGGG - Intergenic
1122300777 14:100729867-100729889 GTCCCCAACATTAGTAAAGACGG + Intronic
1124134209 15:27019742-27019764 GTCCCCAAAAGCAGGAAAGATGG + Intronic
1125951219 15:43753509-43753531 GTACGCCACATTATTAAAGAGGG - Intronic
1134015021 16:10882266-10882288 GACCCCAAAAATTGTAAAGATGG + Intronic
1139149620 16:64365995-64366017 GTTCCCATGATTAGTAAATAAGG + Intergenic
1144855432 17:18264786-18264808 CTCCCCAGCATTAGAAAACATGG - Exonic
1145112862 17:20179552-20179574 GTCCCCAGGCTTAGGAAAGAAGG + Intronic
1145175440 17:20697207-20697229 GTCACCAACACTACTAGAGAAGG - Intergenic
1148283953 17:46371807-46371829 TTTCCCAACATGAGGAAAGAAGG - Intergenic
1148306174 17:46589728-46589750 TTTCCCAACATGAGGAAAGAAGG - Intergenic
1148333387 17:46825357-46825379 GTCTCCAACCTTAGTCACGATGG + Intronic
1152825683 17:82463395-82463417 GTCAGCAACATAAGTACAGATGG + Intronic
1154020382 18:10659628-10659650 GTCCTGTCCATTAGTAAAGATGG - Intergenic
1156156209 18:34305451-34305473 GTCCCAGATATTAGTAAAAAGGG - Intergenic
1158186956 18:54781222-54781244 GTCTCTAACATTAGTATAGAAGG + Intronic
1161623107 19:5309656-5309678 GTCCTGAACATCGGTAAAGACGG - Intronic
1163199570 19:15755577-15755599 GTCCAAAAGATTAATAAAGAGGG - Intergenic
927744594 2:25605698-25605720 CTCCCCAATATTAATAAAGATGG + Intronic
946992950 2:225356183-225356205 GCCCCCAAAATTAGTTAATAAGG - Intergenic
1169704928 20:8492565-8492587 CTCCCCAACATATGTACAGAAGG - Intronic
1175660142 20:60805233-60805255 TTCTCCAACATTAGGAAATATGG + Intergenic
1178933483 21:36840344-36840366 GTCCCCATCAATAGTTATGAAGG - Intronic
950043453 3:9934420-9934442 GTCCCCAGCCTGGGTAAAGATGG + Exonic
953429336 3:42824776-42824798 GTTCCCAACATTATTCATGATGG - Intronic
954948422 3:54447056-54447078 GTCCACAACATTTGAAAACATGG - Intronic
955503078 3:59604398-59604420 TTCCCCTATATTACTAAAGAGGG - Intergenic
955579824 3:60406772-60406794 GTTGCCAACATTAGGGAAGAAGG - Intronic
955708738 3:61756065-61756087 GTCCCCAAGATGATTGAAGATGG + Intronic
960338520 3:116446643-116446665 ATCCTCAACATCAGTAATGAGGG - Intronic
965399188 3:168197759-168197781 GCCCCAAACATTATTAAAAATGG - Intergenic
965630441 3:170727089-170727111 ATCCACAACATCAGGAAAGAAGG - Intronic
966694306 3:182774071-182774093 GATCACATCATTAGTAAAGAGGG + Intergenic
967754408 3:193152551-193152573 GTCCTAAACATTAGTAACCAGGG + Intergenic
968541502 4:1170674-1170696 GTCCCCAACAGTGGTGCAGAGGG - Intronic
970528420 4:16956549-16956571 TTCCCCAACATTAGTCAGGGAGG - Intergenic
970550951 4:17180608-17180630 CTCCCCAAGATTAGCAAATATGG - Intergenic
974452626 4:62086512-62086534 GTCACCAACAGCAGCAAAGAAGG + Intergenic
974602224 4:64098589-64098611 TTCCCCAATATTAGTGATGATGG - Intergenic
975089210 4:70381093-70381115 TGCCCCAACATCAGTGAAGATGG - Intronic
984973722 4:185211365-185211387 GTCTCAAAAATTAGTAAAGTTGG + Intronic
986010278 5:3707901-3707923 CTCCCCACCCTTAGTCAAGATGG - Intergenic
986848746 5:11785745-11785767 TTCCCCAACTTTATCAAAGAGGG + Intronic
987116853 5:14732564-14732586 GTCCCTAACATAGGGAAAGAGGG - Intronic
992904180 5:81329254-81329276 GTCAACAAAATTAGTAATGAAGG - Intergenic
993088016 5:83387910-83387932 GACCCCAAAATGAGAAAAGATGG - Intergenic
993161773 5:84300439-84300461 TTCCCCTGCATTAGGAAAGATGG + Intronic
994093991 5:95832418-95832440 GTCCCCAACTTTGATAAAGGAGG + Intergenic
997830844 5:137148332-137148354 GTCCTGATCATTAGAAAAGAAGG + Intronic
998973830 5:147622862-147622884 ATTCCCATCAATAGTAAAGAAGG + Intronic
1000424902 5:161079093-161079115 GTCCCTAAGATTAGTAAGAATGG - Intergenic
1004764112 6:18705227-18705249 GTGCCCAACATTACTAATCAGGG - Intergenic
1010396272 6:75396115-75396137 GCTCCCAACATTATTTAAGATGG + Intronic
1015843635 6:137496868-137496890 CTCCCCCAAATTAGTAACGAAGG + Intergenic
1023893741 7:44414464-44414486 GTCCCCACCTTTAGCACAGATGG - Intronic
1024747626 7:52426880-52426902 CTCACCAACATGTGTAAAGAAGG - Intergenic
1026166563 7:67915434-67915456 GTCACCAACATTTGTTACGATGG + Intergenic
1026434918 7:70387613-70387635 ATGGCCAACATTAGGAAAGACGG - Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1034137633 7:148785891-148785913 GTCTCCAACTTTAGAAAAGTTGG - Intronic
1043168026 8:76928601-76928623 GTCACCATTATTAGTAATGAGGG - Intergenic
1050568802 9:6916098-6916120 GTCAGCAACCTGAGTAAAGATGG + Intronic
1050573559 9:6967915-6967937 GATTCCAACATTAGTAAAGTAGG + Intronic
1058576121 9:106403667-106403689 GACGCTAACATTAGAAAAGAAGG + Intergenic
1201704450 Y:16920845-16920867 GTGCCCAACATTAGTAGACTAGG + Intergenic