ID: 1122302257

View in Genome Browser
Species Human (GRCh38)
Location 14:100737859-100737881
Sequence TGACACTGCTTCTGTGGCAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122302257_1122302260 -8 Left 1122302257 14:100737859-100737881 CCCGTGCCACAGAAGCAGTGTCA 0: 1
1: 0
2: 2
3: 19
4: 202
Right 1122302260 14:100737874-100737896 CAGTGTCAGCAGCCTCGCCACGG 0: 1
1: 0
2: 0
3: 14
4: 205
1122302257_1122302263 14 Left 1122302257 14:100737859-100737881 CCCGTGCCACAGAAGCAGTGTCA 0: 1
1: 0
2: 2
3: 19
4: 202
Right 1122302263 14:100737896-100737918 GTCTTCACGTCATGCAGAAATGG 0: 1
1: 0
2: 0
3: 4
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122302257 Original CRISPR TGACACTGCTTCTGTGGCAC GGG (reversed) Exonic
900196910 1:1381155-1381177 AGCCATGGCTTCTGTGGCACGGG + Intergenic
901216494 1:7558258-7558280 TGCCTCTGCTCCTGTGGGACTGG + Intronic
903744803 1:25579640-25579662 GGTAGCTGCTTCTGTGGCACTGG - Intergenic
904483452 1:30808163-30808185 TGTCTGTGCTCCTGTGGCACAGG - Intergenic
907113642 1:51949792-51949814 CACCACTGCTTCTGTCGCACGGG + Intronic
907856034 1:58304377-58304399 TGACACTTCTTCTGAAGCAGAGG + Intronic
907932801 1:59015925-59015947 TGACTCAGCTTCTGTTGCATAGG + Intergenic
910112869 1:83701040-83701062 TAACTCTGCTTTTGTGACACTGG + Intergenic
911695586 1:100887633-100887655 TGCCACTCTTTCTGTGGCTCAGG - Intronic
914416790 1:147491364-147491386 GGACCATGCTTCTGTGGAACTGG + Intergenic
915306168 1:154980431-154980453 AGACACAGCTTCTGTCGCCCAGG - Intergenic
916853504 1:168727104-168727126 TGAATCTGGTCCTGTGGCACTGG + Intronic
917442471 1:175079638-175079660 GGCCACGGCTTCTGTGACACGGG + Exonic
918377263 1:183921832-183921854 TTGAACTGCTTCTATGGCACTGG - Intronic
920038965 1:203083836-203083858 TGCCACTACTTCTGTAGCAGGGG - Exonic
920183886 1:204148875-204148897 TGACACTGGGACAGTGGCACGGG - Intronic
921749081 1:218771732-218771754 TGACAGTGATTCTGTGGAAAGGG + Intergenic
924739802 1:246788350-246788372 TGCCACTGCCCCTGTGGCCCTGG - Intergenic
1063454645 10:6174570-6174592 TGTTTCTGTTTCTGTGGCACTGG + Intronic
1064273405 10:13885343-13885365 TGCCACTGCTTATGTGGCCTTGG - Intronic
1065800897 10:29351422-29351444 TGCCACTGCTGCTCTGGAACTGG + Intergenic
1066668431 10:37811258-37811280 TGTCACTGCAGCTGTGCCACAGG + Intronic
1067921321 10:50460814-50460836 TGAAACTGCTTCTCTGTCCCAGG - Exonic
1070934802 10:80284778-80284800 TGACTCTGCCACTGTGCCACAGG + Intronic
1070961994 10:80505704-80505726 TGAACCTGCTTCTGGGTCACTGG - Intronic
1071008350 10:80909678-80909700 TCACCCTGCTTCTCTGGCACTGG + Intergenic
1074961042 10:118446229-118446251 TGCCACTGCTTCTGTGACCTTGG - Intergenic
1080848163 11:36044570-36044592 TGAAGGTGTTTCTGTGGCACAGG - Intronic
1081184543 11:40026009-40026031 TGACAGTGCTACTCTGGGACTGG + Intergenic
1081312899 11:41594611-41594633 TCACACAGCTTCTGTGGCTCAGG - Intergenic
1084746749 11:71175330-71175352 TGACACCACCTCTGTGGCTCAGG - Intronic
1085217099 11:74842912-74842934 TGACAATGCTGCTGTGGCCTGGG + Exonic
1087303289 11:96460133-96460155 TGACTCTGGTTCTGGGGCTCGGG - Intronic
1088564497 11:111153846-111153868 TGACTCTGCTGCTGTGCTACAGG - Intergenic
1089330522 11:117685997-117686019 TGATGCTGCATCTGTGCCACTGG + Intronic
1091354546 11:134926070-134926092 TGACTCTGATTCAGTGCCACAGG + Intergenic
1092766599 12:11858734-11858756 TGAGATTGTTTCTGTAGCACTGG + Intronic
1096793278 12:54058362-54058384 TGCCACTGCTTTTGTAGGACTGG + Intergenic
1097705764 12:62866732-62866754 TCACACTGTTTCTGTGGGTCAGG - Intronic
1100089430 12:90952871-90952893 TGAAGTTGCTTCTGTGGAACTGG - Exonic
1100125398 12:91418463-91418485 TCACACTGCTTCTGTTTCTCTGG - Intergenic
1100141341 12:91622387-91622409 TGTTCCTTCTTCTGTGGCACAGG + Intergenic
1101880671 12:108623489-108623511 GGACAGGGCCTCTGTGGCACTGG + Exonic
1101936107 12:109058656-109058678 TGAAACTGTTTATGTGGCAGTGG - Intronic
1102326742 12:111992234-111992256 TGAGAGTGCTTTAGTGGCACAGG + Intronic
1103931333 12:124452666-124452688 GGACAGTGCTTCTGCGGCACAGG + Intronic
1103977748 12:124714629-124714651 TGGCTCTGCTTCTGGGGCCCTGG + Intergenic
1108527532 13:51298816-51298838 AGCCACTGCTGCTGTGACACTGG + Intergenic
1110290871 13:73805582-73805604 TGACAGTGCCTCTGTTGCCCAGG - Intronic
1112746890 13:102536785-102536807 TGACGTTTCTCCTGTGGCACAGG - Intergenic
1114741453 14:25102461-25102483 TGACTCTGCGTGTGTAGCACTGG - Intergenic
1114835138 14:26195077-26195099 TGACACTGCATCTTTTGCCCAGG - Intergenic
1115777984 14:36737201-36737223 TTACACTGCTTCTCTGGAAGAGG + Intronic
1119332428 14:73804824-73804846 TGACCCTGCTGCTGTTGCCCTGG - Intergenic
1122302257 14:100737859-100737881 TGACACTGCTTCTGTGGCACGGG - Exonic
1122831168 14:104396713-104396735 TTACACTGCTTCTCTGGCATCGG + Intergenic
1123219230 14:106841102-106841124 TGCTACTGCTTCACTGGCACAGG - Intergenic
1123813183 15:23949636-23949658 GGAAACTGTGTCTGTGGCACAGG + Intergenic
1128259408 15:66222101-66222123 TGAAGCTGCTGCTGTGGTACCGG - Intronic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1131097181 15:89663532-89663554 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097185 15:89663552-89663574 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097193 15:89663592-89663614 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097201 15:89663632-89663654 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097209 15:89663672-89663694 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097217 15:89663712-89663734 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097261 15:89663932-89663954 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097269 15:89663972-89663994 TGGCACTGACTCTGTGGCCCTGG - Intergenic
1131097277 15:89664012-89664034 TGAAACTGACTCTGTGGCCCTGG - Intergenic
1131798356 15:96043881-96043903 TGCCACTGTGTGTGTGGCACAGG + Intergenic
1133685633 16:8162886-8162908 TGAAACTCCTTCCGTGGCTCGGG - Intergenic
1135023300 16:18980336-18980358 TGACACTTCCCCTGTGCCACAGG + Intergenic
1135694084 16:24572199-24572221 TGGCACTGCTACTGTGGCTTCGG - Exonic
1135947286 16:26876325-26876347 TGACATTCCTTCTGTGATACTGG - Intergenic
1136006965 16:27337373-27337395 TGGCTGTGTTTCTGTGGCACAGG - Intronic
1137446808 16:48536899-48536921 TGACACAGCTTCTGCAGAACTGG + Intergenic
1141439092 16:84017773-84017795 TGACACTGCTTCTGTCACCCCGG + Intronic
1144503613 17:15810053-15810075 TGACTCTGCATCTGTGGCTGGGG + Intergenic
1145923459 17:28628604-28628626 TATCACTGCCTCTGTGGCACTGG - Intronic
1147640097 17:41992121-41992143 TGCCTCTCCTTCAGTGGCACAGG + Intronic
1148738412 17:49878164-49878186 CCACCCTGCTGCTGTGGCACTGG + Intergenic
1148953589 17:51335542-51335564 TATAACTGCTTCTGTGGCTCTGG - Intergenic
1149022376 17:51983855-51983877 TGTCACTGCTTGGGTGGCAGGGG + Intronic
1151245962 17:72794859-72794881 TCACACTGTTTCTGTGGGTCAGG + Intronic
1151769485 17:76150687-76150709 TGGGAATGCTTCTGTGGCAAGGG - Intronic
1153076806 18:1171874-1171896 TTACTCTGCTTCTGTGACCCTGG - Intergenic
1153531953 18:6055759-6055781 AGTCACTGTTTCTCTGGCACTGG - Intronic
1154001899 18:10488829-10488851 TGTCACTGCTCCTGTGTAACAGG - Exonic
1154335058 18:13458337-13458359 TGACTTTGCTTCTGTGGCTGAGG + Intronic
1156765383 18:40647676-40647698 AAACACTGCTTCTGTGGGCCTGG - Intergenic
1157800272 18:50614779-50614801 TCACACTACTTCAGTGGTACTGG + Intronic
1158976642 18:62716207-62716229 AGACGCTGCTTCTGAAGCACCGG + Exonic
1159563632 18:70023258-70023280 TGCCACGGCTTCTGTGGCTCAGG - Intronic
1159765670 18:72485351-72485373 TCAGCCTGCTTCTGTGCCACAGG + Intergenic
1159871237 18:73761654-73761676 GGACACTGCTTCTGAGCCAAAGG - Intergenic
1160214247 18:76913350-76913372 TGATTCTGCTTCTGAGGCAATGG + Intronic
1160588876 18:79928721-79928743 CGCCACTGCTGCAGTGGCACTGG - Intronic
1162957168 19:14105776-14105798 TAAAATTGCTTCTGTGGCTCAGG + Intronic
1163369903 19:16896264-16896286 TGACCTGGCTTCTGTGGCCCCGG - Exonic
1165232107 19:34393706-34393728 TGACTCTGCTTTTGTGTCACAGG + Exonic
1165393855 19:35553356-35553378 TGTCACTGTTTCTGTGTCCCTGG - Intronic
1165639987 19:37376324-37376346 TCACTCTGTTTCTGTTGCACAGG - Intronic
926960538 2:18353872-18353894 GGGCACTGGTTCTGGGGCACCGG - Intronic
930257268 2:49106653-49106675 TGACACCGAATCTGTGTCACTGG + Intronic
930672729 2:54168398-54168420 GGAGTCTGCTTCTGTGGCCCAGG - Intronic
932220339 2:69994371-69994393 TGACACAGCATCTGTGGCCATGG + Intergenic
932309340 2:70727312-70727334 TGACCCTGCCTCTGTGGCTGGGG + Intronic
935496572 2:103789450-103789472 TAACAATGATTCTGTGGCATGGG + Intergenic
937882931 2:126882022-126882044 TGGCACTGTTTGTCTGGCACAGG - Intergenic
939290279 2:140185171-140185193 TGTCACTGCTTCTTTTGCAGGGG - Intergenic
939466460 2:142562625-142562647 TGTTACTGCATCTGTGGCTCAGG - Intergenic
939834385 2:147110587-147110609 TTAGACTGCTTCTCTGGCACGGG - Intergenic
940578346 2:155544244-155544266 ATACACTGCTGCTGTGTCACAGG - Intergenic
942921203 2:181375522-181375544 TGACTCTGCTTCTGTGGCCAGGG + Intergenic
945781944 2:214186225-214186247 TGAGACTCCTCCTGTGGCAGTGG - Intronic
945791400 2:214310051-214310073 TCACACTACTTCTATGGCAATGG - Intronic
947387840 2:229609701-229609723 TGACACTGCTGCTGTGTCTATGG - Intronic
948478644 2:238237218-238237240 CAAGACTTCTTCTGTGGCACTGG + Intergenic
1173687386 20:44933112-44933134 TGACACTGCTGATGTGGGCCGGG - Exonic
1174269297 20:49355423-49355445 TCACACAGTTTCTGTGGCTCAGG - Intergenic
1175502800 20:59462159-59462181 TGTCACTGCTCATGGGGCACTGG + Intergenic
1176004470 20:62852768-62852790 TGACCGTGCTTCTGTGGAATGGG - Intronic
1176004504 20:62853021-62853043 TGACTATGCTTCTGTGGACCGGG - Intronic
1177107433 21:16977695-16977717 TGACACTGCTTCTGTGAATAAGG + Intergenic
1177329654 21:19641257-19641279 TGACACGGCTGCTGTTTCACTGG + Intergenic
1179724534 21:43334442-43334464 TGAGGCTGCTTCTGTGGCCCAGG + Intergenic
1180180437 21:46116481-46116503 TGTCACTGCTCCTGGGGCACCGG + Intronic
1180653468 22:17398587-17398609 CCACAGTGCTTCTGTGACACTGG + Intronic
1180979899 22:19873518-19873540 CCACACTTCTGCTGTGGCACCGG - Intergenic
1180995317 22:19962591-19962613 TGCTGCTGCTTCTGAGGCACTGG + Exonic
1184143672 22:42595482-42595504 TCAAACTGCCTCTGTGGCAAAGG - Intronic
1184294969 22:43517353-43517375 TCACACAGTTACTGTGGCACTGG - Intergenic
1184495016 22:44835694-44835716 TAACACTCCTTCTTTGCCACTGG + Intronic
950841008 3:15968437-15968459 TGACACTCATTCTGTTGCTCAGG - Intergenic
951802268 3:26609060-26609082 TGACAATGAGTCTGTGGCCCTGG + Intergenic
953755564 3:45643110-45643132 TGCTGCTGCTTCTGAGGCACAGG - Intronic
954437192 3:50502665-50502687 GGACACTGCCTCTGTGGCACTGG + Intronic
954877987 3:53815726-53815748 TGACCCTTCTTCTCTGGAACAGG - Exonic
955986176 3:64576289-64576311 TGACGCTGCTTCTGTGGCTCAGG - Intronic
960354016 3:116628923-116628945 TGACACAGCTGGTGTTGCACCGG + Intronic
960677401 3:120209529-120209551 TGATACTGCTGCTCTGGCCCAGG + Intronic
961325904 3:126109240-126109262 TGACGCTGCTGCTGGGGGACAGG - Intronic
961660581 3:128466792-128466814 AGACCCTGCTTCTGAGCCACAGG + Exonic
962316160 3:134360723-134360745 TCACACTACCTCTGTGGCAAGGG + Intronic
963972659 3:151446741-151446763 AGACAATGCTGCTGTGGCAGTGG + Exonic
966167555 3:177037642-177037664 TGGCACTCCTTCTCTGGCCCTGG + Intronic
966620890 3:181963068-181963090 TGACAGTGCTTCATTGGCACAGG + Intergenic
970370863 4:15405267-15405289 TGACATTGCATCTGTGTCAGAGG + Intronic
973791383 4:54381115-54381137 AGCCACTGCATCTGTGGTACTGG + Intergenic
977097215 4:92761598-92761620 TGACCCTGGTTCTGTGTCAGTGG + Intronic
982269048 4:153568154-153568176 TGAGAATGCTTCTGTGGAATGGG + Intronic
986489273 5:8272641-8272663 TGAAACTGTTTCTGTGCAACCGG + Intergenic
986679413 5:10219959-10219981 TGACACTGCTTCATTGCCAAGGG - Intergenic
987795339 5:22620691-22620713 TGACACTAATTCTATGACACAGG - Intronic
989795243 5:45461924-45461946 TGATGCTGCTCCTGTGCCACTGG - Exonic
991598874 5:68332986-68333008 TGACACTAGCTCTGTGGCCCTGG - Intergenic
992693428 5:79260908-79260930 TGATACTGCATCTGTGGCCCTGG - Intronic
994059559 5:95459227-95459249 TAACACTTGTTCTGAGGCACAGG + Intergenic
995048594 5:107675708-107675730 AGTCATTGCTTCTGTGACACTGG - Intergenic
995134407 5:108665321-108665343 TGCCAATGCATCTATGGCACAGG - Intergenic
996368733 5:122730654-122730676 TGACACTGCTACTGTCACAATGG - Intergenic
996525781 5:124477973-124477995 TGTCACTGATTCAGTGACACTGG + Intergenic
998469272 5:142370630-142370652 TCACACTGCCAATGTGGCACAGG - Intergenic
998904725 5:146892658-146892680 AGACACTGATTCTGTGCCATTGG - Intronic
999629489 5:153555475-153555497 TGACACTGCTCCTGCTGCACTGG + Intronic
999865417 5:155695450-155695472 TGACTCTGCCTGTGTTGCACTGG - Intergenic
1002880494 6:1246515-1246537 TATCACTGTTTCTGTGGCCCAGG - Intergenic
1004125067 6:12865176-12865198 AGGCACAGCTTCTGTGGCACTGG + Intronic
1006168897 6:32081826-32081848 TGACACACCTTCTGGGCCACGGG + Intronic
1006621246 6:35365890-35365912 TGACAATGCTTCTGTGTGATAGG + Intronic
1006823375 6:36916051-36916073 TGACCCTTCTTCTGAGGCACAGG - Intronic
1007380817 6:41488938-41488960 GGACACAGCTTCTGGGGCCCGGG + Intergenic
1007515277 6:42405944-42405966 TGACGGTGCTTCTGTGTCATGGG - Intronic
1009941571 6:70295212-70295234 TGACACTGGATATGTGGCAAGGG + Intronic
1016013772 6:139164111-139164133 TCACACTGCTCCTGAAGCACAGG + Intronic
1018721176 6:166573619-166573641 TCACACTGACTCTGTGGCTCCGG + Intronic
1019408157 7:894667-894689 TGACGGCGCTTCTGTGGAACGGG - Intronic
1020244820 7:6422094-6422116 TGGCACAGGTTCTGTGCCACGGG - Intronic
1021112265 7:16709024-16709046 TGCCACAGCTTCTGTGGGTCTGG + Intergenic
1021533594 7:21676973-21676995 TGACAGTTCTTCAGTGGCTCTGG + Intronic
1021931832 7:25588705-25588727 TGACACTGCCTCTCTGGAAGTGG + Intergenic
1022488502 7:30798927-30798949 TGACATTTCTCCTCTGGCACTGG + Intronic
1027468281 7:78541606-78541628 TGACACTGCTGCTGTTGCTCTGG - Intronic
1028906263 7:96157457-96157479 TGACACTTCTGGTTTGGCACAGG + Intronic
1029688775 7:102166544-102166566 TGACACTGGTTTTGAGGCTCTGG - Intronic
1029696497 7:102217145-102217167 TGGCCCTGCTTCAGGGGCACAGG - Intronic
1032802021 7:135324508-135324530 TGGCACTGCATATATGGCACAGG - Intergenic
1033800292 7:144893115-144893137 TATCACTGCTTCTGAGCCACAGG + Intergenic
1035134265 7:156685274-156685296 TGTAAGAGCTTCTGTGGCACTGG + Intronic
1035312469 7:157978176-157978198 AGACACGGCTCCTCTGGCACAGG + Intronic
1035957993 8:4104104-4104126 ACACTCTGCTTCTGTGGGACAGG - Intronic
1036206822 8:6811689-6811711 TGACGCTGTTTCTGGGACACAGG - Exonic
1037451006 8:19014964-19014986 TCACACTGCTGCTCTGGCAGGGG - Intronic
1037810300 8:22082677-22082699 AGCCCCTGCTTCTGTGGCCCAGG - Intergenic
1042162508 8:65911765-65911787 TGCCACTGCTGCTGGGGCATGGG - Intergenic
1042339878 8:67667383-67667405 TGATATTAGTTCTGTGGCACTGG - Intronic
1042652943 8:71062898-71062920 TTACACTGCTTCTTTGTCTCCGG + Intergenic
1043142909 8:76612815-76612837 TAAATCTGCTTCTGTTGCACGGG + Intergenic
1043210446 8:77507656-77507678 TACCACTGCTGCTGTGGCTCTGG - Intergenic
1049338252 8:142097954-142097976 TGACCCTGATTCTGTGGGGCTGG - Intergenic
1049771979 8:144387271-144387293 TGACACTGCTTCTGTCCTGCCGG + Intronic
1051822207 9:21181289-21181311 TAAAACTGCTGCTGTGGCAGTGG - Intergenic
1051823440 9:21193350-21193372 TAAAACTGCTGCTGTGGCAGTGG - Intergenic
1051825257 9:21211887-21211909 TAAAACTGCTGCTGTGGCAGTGG - Intronic
1051827240 9:21233948-21233970 TAAAACTGCTGCTGTGGCAGTGG - Intronic
1053002452 9:34584791-34584813 TCACACCGATTCTGTGGCAGAGG - Intronic
1053576820 9:39362658-39362680 TGACCCTGCTCCTGGGTCACCGG + Intergenic
1053841333 9:42190583-42190605 TGACCCTGCTCCTGGGTCACCGG + Intergenic
1054098390 9:60921349-60921371 TGACCCTGCTCCTGGGTCACCGG + Intergenic
1054119791 9:61196979-61197001 TGACCCTGCTCCTGGGTCACCGG + Intergenic
1054587963 9:66985583-66985605 TGACCCTGCTCCTGGGTCACCGG - Intergenic
1056091397 9:83208988-83209010 TGACTCAGCTTCTGTGCCTCAGG + Intergenic
1058679751 9:107430639-107430661 TGATGCTGCTTCTCTGGCCCAGG + Intergenic
1059283626 9:113154693-113154715 TGACTCTGCCTCTGTGGATCCGG + Intronic
1059782905 9:117548739-117548761 TGACCCTGCTCCTGTGGTGCTGG - Intergenic
1060797029 9:126519642-126519664 TGCCACTGCCTCTGTGACCCTGG + Intergenic
1062397447 9:136358182-136358204 TGGCACTGCTGCTGGGGCTCGGG - Exonic
1186829489 X:13376499-13376521 TGACACAACTTCTGTGGGAGTGG - Intergenic
1187286718 X:17912371-17912393 TGACACTGCCTGGATGGCACAGG - Intergenic
1192307763 X:69981285-69981307 TGAGATTGCTTTTGTGGTACAGG - Intronic
1194383906 X:93229413-93229435 TAGCACTACTTCTGTAGCACTGG - Intergenic
1195208175 X:102625021-102625043 AGAAACTGCTACTGTGGCAGTGG + Intergenic
1198528629 X:137526883-137526905 TGACTCTGATTCTGTGGCGTAGG + Intergenic
1199559991 X:149151792-149151814 TGACACTGCTGCAGTGGCAATGG + Intergenic