ID: 1122307610

View in Genome Browser
Species Human (GRCh38)
Location 14:100775803-100775825
Sequence CAGGGTCAAGACCCTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122307607_1122307610 -6 Left 1122307607 14:100775786-100775808 CCATAGGGGGAAATGGCCAGGGT No data
Right 1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG No data
1122307597_1122307610 25 Left 1122307597 14:100775755-100775777 CCTGCGACTTCTCTGGGCTCAGT No data
Right 1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG No data
1122307603_1122307610 0 Left 1122307603 14:100775780-100775802 CCCTCTCCATAGGGGGAAATGGC No data
Right 1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG No data
1122307604_1122307610 -1 Left 1122307604 14:100775781-100775803 CCTCTCCATAGGGGGAAATGGCC No data
Right 1122307610 14:100775803-100775825 CAGGGTCAAGACCCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122307610 Original CRISPR CAGGGTCAAGACCCTGGAGC TGG Intergenic
No off target data available for this crispr