ID: 1122307978

View in Genome Browser
Species Human (GRCh38)
Location 14:100777434-100777456
Sequence CCCAGCAAGCAGGGCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122307966_1122307978 22 Left 1122307966 14:100777389-100777411 CCCTCTCTTCTATCTCAGAGTGC No data
Right 1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG No data
1122307967_1122307978 21 Left 1122307967 14:100777390-100777412 CCTCTCTTCTATCTCAGAGTGCC No data
Right 1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG No data
1122307970_1122307978 0 Left 1122307970 14:100777411-100777433 CCAAATGGGCCATTTTCCTCTTC No data
Right 1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG No data
1122307971_1122307978 -9 Left 1122307971 14:100777420-100777442 CCATTTTCCTCTTCCCCAGCAAG No data
Right 1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG No data
1122307965_1122307978 26 Left 1122307965 14:100777385-100777407 CCTTCCCTCTCTTCTATCTCAGA No data
Right 1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122307978 Original CRISPR CCCAGCAAGCAGGGCCTGGA AGG Intergenic
No off target data available for this crispr