ID: 1122308576

View in Genome Browser
Species Human (GRCh38)
Location 14:100780657-100780679
Sequence AGGGGTAAAGACTTTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122308576_1122308583 5 Left 1122308576 14:100780657-100780679 CCAACCTCAAAGTCTTTACCCCT No data
Right 1122308583 14:100780685-100780707 TAACAAACAAGTGGAAGATCAGG No data
1122308576_1122308586 14 Left 1122308576 14:100780657-100780679 CCAACCTCAAAGTCTTTACCCCT No data
Right 1122308586 14:100780694-100780716 AGTGGAAGATCAGGAACACGGGG No data
1122308576_1122308585 13 Left 1122308576 14:100780657-100780679 CCAACCTCAAAGTCTTTACCCCT No data
Right 1122308585 14:100780693-100780715 AAGTGGAAGATCAGGAACACGGG No data
1122308576_1122308580 -4 Left 1122308576 14:100780657-100780679 CCAACCTCAAAGTCTTTACCCCT No data
Right 1122308580 14:100780676-100780698 CCCTCTGCCTAACAAACAAGTGG No data
1122308576_1122308584 12 Left 1122308576 14:100780657-100780679 CCAACCTCAAAGTCTTTACCCCT No data
Right 1122308584 14:100780692-100780714 CAAGTGGAAGATCAGGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122308576 Original CRISPR AGGGGTAAAGACTTTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr