ID: 1122308937 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:100782696-100782718 |
Sequence | GAAATGGCCCAGTTGCAGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122308928_1122308937 | 25 | Left | 1122308928 | 14:100782648-100782670 | CCGGCCTGGTAACTCGTTGGCTG | No data | ||
Right | 1122308937 | 14:100782696-100782718 | GAAATGGCCCAGTTGCAGCTGGG | No data | ||||
1122308930_1122308937 | 21 | Left | 1122308930 | 14:100782652-100782674 | CCTGGTAACTCGTTGGCTGTGGA | No data | ||
Right | 1122308937 | 14:100782696-100782718 | GAAATGGCCCAGTTGCAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122308937 | Original CRISPR | GAAATGGCCCAGTTGCAGCT GGG | Intergenic | ||
No off target data available for this crispr |