ID: 1122308937

View in Genome Browser
Species Human (GRCh38)
Location 14:100782696-100782718
Sequence GAAATGGCCCAGTTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122308928_1122308937 25 Left 1122308928 14:100782648-100782670 CCGGCCTGGTAACTCGTTGGCTG No data
Right 1122308937 14:100782696-100782718 GAAATGGCCCAGTTGCAGCTGGG No data
1122308930_1122308937 21 Left 1122308930 14:100782652-100782674 CCTGGTAACTCGTTGGCTGTGGA No data
Right 1122308937 14:100782696-100782718 GAAATGGCCCAGTTGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122308937 Original CRISPR GAAATGGCCCAGTTGCAGCT GGG Intergenic
No off target data available for this crispr