ID: 1122309639

View in Genome Browser
Species Human (GRCh38)
Location 14:100786307-100786329
Sequence GTCCACCCACTTCCAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309628_1122309639 22 Left 1122309628 14:100786262-100786284 CCCATTATCCCTCCGGGGGGACG No data
Right 1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG No data
1122309634_1122309639 10 Left 1122309634 14:100786274-100786296 CCGGGGGGACGTTCGGAGGCATC No data
Right 1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG No data
1122309633_1122309639 13 Left 1122309633 14:100786271-100786293 CCTCCGGGGGGACGTTCGGAGGC No data
Right 1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG No data
1122309629_1122309639 21 Left 1122309629 14:100786263-100786285 CCATTATCCCTCCGGGGGGACGT No data
Right 1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG No data
1122309631_1122309639 14 Left 1122309631 14:100786270-100786292 CCCTCCGGGGGGACGTTCGGAGG No data
Right 1122309639 14:100786307-100786329 GTCCACCCACTTCCAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309639 Original CRISPR GTCCACCCACTTCCAAAGAA GGG Intergenic
No off target data available for this crispr