ID: 1122309650

View in Genome Browser
Species Human (GRCh38)
Location 14:100786373-100786395
Sequence GGGCTGGCTGGGCACCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309650_1122309667 28 Left 1122309650 14:100786373-100786395 CCTCCCTGGTGCCCAGCCAGCCC No data
Right 1122309667 14:100786424-100786446 TGTCCTGCATGCCAGGGATGTGG No data
1122309650_1122309668 29 Left 1122309650 14:100786373-100786395 CCTCCCTGGTGCCCAGCCAGCCC No data
Right 1122309668 14:100786425-100786447 GTCCTGCATGCCAGGGATGTGGG No data
1122309650_1122309666 22 Left 1122309650 14:100786373-100786395 CCTCCCTGGTGCCCAGCCAGCCC No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309650_1122309665 21 Left 1122309650 14:100786373-100786395 CCTCCCTGGTGCCCAGCCAGCCC No data
Right 1122309665 14:100786417-100786439 GAGTCTGTGTCCTGCATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309650 Original CRISPR GGGCTGGCTGGGCACCAGGG AGG (reversed) Intergenic