ID: 1122309652

View in Genome Browser
Species Human (GRCh38)
Location 14:100786377-100786399
Sequence CTCTGGGCTGGCTGGGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309652_1122309668 25 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309668 14:100786425-100786447 GTCCTGCATGCCAGGGATGTGGG No data
1122309652_1122309666 18 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309652_1122309665 17 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309665 14:100786417-100786439 GAGTCTGTGTCCTGCATGCCAGG No data
1122309652_1122309670 29 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309670 14:100786429-100786451 TGCATGCCAGGGATGTGGGATGG No data
1122309652_1122309667 24 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309667 14:100786424-100786446 TGTCCTGCATGCCAGGGATGTGG No data
1122309652_1122309671 30 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309652 Original CRISPR CTCTGGGCTGGCTGGGCACC AGG (reversed) Intergenic