ID: 1122309659

View in Genome Browser
Species Human (GRCh38)
Location 14:100786393-100786415
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309659_1122309672 15 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309672 14:100786431-100786453 CATGCCAGGGATGTGGGATGGGG No data
1122309659_1122309671 14 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309659_1122309667 8 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309667 14:100786424-100786446 TGTCCTGCATGCCAGGGATGTGG No data
1122309659_1122309673 16 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309673 14:100786432-100786454 ATGCCAGGGATGTGGGATGGGGG No data
1122309659_1122309666 2 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309659_1122309668 9 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309668 14:100786425-100786447 GTCCTGCATGCCAGGGATGTGGG No data
1122309659_1122309665 1 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309665 14:100786417-100786439 GAGTCTGTGTCCTGCATGCCAGG No data
1122309659_1122309670 13 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309670 14:100786429-100786451 TGCATGCCAGGGATGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309659 Original CRISPR GGGCTCAGCGGCCCCTCTCT GGG (reversed) Intergenic