ID: 1122309663

View in Genome Browser
Species Human (GRCh38)
Location 14:100786414-100786436
Sequence GGCATGCAGGACACAGACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309663_1122309672 -6 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309672 14:100786431-100786453 CATGCCAGGGATGTGGGATGGGG No data
1122309663_1122309679 27 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309679 14:100786464-100786486 CATCCAGTGGCAGTGCCCCCGGG No data
1122309663_1122309678 26 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data
1122309663_1122309671 -7 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309663_1122309670 -8 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309670 14:100786429-100786451 TGCATGCCAGGGATGTGGGATGG No data
1122309663_1122309675 14 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309675 14:100786451-100786473 GGGGACCTCCAAGCATCCAGTGG No data
1122309663_1122309673 -5 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309673 14:100786432-100786454 ATGCCAGGGATGTGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309663 Original CRISPR GGCATGCAGGACACAGACTC GGG (reversed) Intergenic