ID: 1122309666

View in Genome Browser
Species Human (GRCh38)
Location 14:100786418-100786440
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309659_1122309666 2 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309658_1122309666 6 Left 1122309658 14:100786389-100786411 CCAGCCCAGAGAGGGGCCGCTGA No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309660_1122309666 1 Left 1122309660 14:100786394-100786416 CCAGAGAGGGGCCGCTGAGCCCC No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309651_1122309666 19 Left 1122309651 14:100786376-100786398 CCCTGGTGCCCAGCCAGCCCAGA No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309661_1122309666 -10 Left 1122309661 14:100786405-100786427 CCGCTGAGCCCCGAGTCTGTGTC No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309657_1122309666 10 Left 1122309657 14:100786385-100786407 CCAGCCAGCCCAGAGAGGGGCCG No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309650_1122309666 22 Left 1122309650 14:100786373-100786395 CCTCCCTGGTGCCCAGCCAGCCC No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309656_1122309666 11 Left 1122309656 14:100786384-100786406 CCCAGCCAGCCCAGAGAGGGGCC No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data
1122309652_1122309666 18 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309666 14:100786418-100786440 AGTCTGTGTCCTGCATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309666 Original CRISPR AGTCTGTGTCCTGCATGCCA GGG Intergenic
No off target data available for this crispr