ID: 1122309669

View in Genome Browser
Species Human (GRCh38)
Location 14:100786427-100786449
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309669_1122309675 1 Left 1122309669 14:100786427-100786449 CCTGCATGCCAGGGATGTGGGAT No data
Right 1122309675 14:100786451-100786473 GGGGACCTCCAAGCATCCAGTGG No data
1122309669_1122309678 13 Left 1122309669 14:100786427-100786449 CCTGCATGCCAGGGATGTGGGAT No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data
1122309669_1122309679 14 Left 1122309669 14:100786427-100786449 CCTGCATGCCAGGGATGTGGGAT No data
Right 1122309679 14:100786464-100786486 CATCCAGTGGCAGTGCCCCCGGG No data
1122309669_1122309681 25 Left 1122309669 14:100786427-100786449 CCTGCATGCCAGGGATGTGGGAT No data
Right 1122309681 14:100786475-100786497 AGTGCCCCCGGGCATGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309669 Original CRISPR ATCCCACATCCCTGGCATGC AGG (reversed) Intergenic