ID: 1122309671

View in Genome Browser
Species Human (GRCh38)
Location 14:100786430-100786452
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309660_1122309671 13 Left 1122309660 14:100786394-100786416 CCAGAGAGGGGCCGCTGAGCCCC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309662_1122309671 -6 Left 1122309662 14:100786413-100786435 CCCCGAGTCTGTGTCCTGCATGC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309663_1122309671 -7 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309656_1122309671 23 Left 1122309656 14:100786384-100786406 CCCAGCCAGCCCAGAGAGGGGCC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309658_1122309671 18 Left 1122309658 14:100786389-100786411 CCAGCCCAGAGAGGGGCCGCTGA No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309664_1122309671 -8 Left 1122309664 14:100786415-100786437 CCGAGTCTGTGTCCTGCATGCCA No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309661_1122309671 2 Left 1122309661 14:100786405-100786427 CCGCTGAGCCCCGAGTCTGTGTC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309652_1122309671 30 Left 1122309652 14:100786377-100786399 CCTGGTGCCCAGCCAGCCCAGAG No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309657_1122309671 22 Left 1122309657 14:100786385-100786407 CCAGCCAGCCCAGAGAGGGGCCG No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data
1122309659_1122309671 14 Left 1122309659 14:100786393-100786415 CCCAGAGAGGGGCCGCTGAGCCC No data
Right 1122309671 14:100786430-100786452 GCATGCCAGGGATGTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309671 Original CRISPR GCATGCCAGGGATGTGGGAT GGG Intergenic