ID: 1122309674

View in Genome Browser
Species Human (GRCh38)
Location 14:100786435-100786457
Sequence GGTCCCCCATCCCACATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309674_1122309681 17 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309681 14:100786475-100786497 AGTGCCCCCGGGCATGAGACCGG No data
1122309674_1122309686 26 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309686 14:100786484-100786506 GGGCATGAGACCGGAGCCACAGG No data
1122309674_1122309675 -7 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309675 14:100786451-100786473 GGGGACCTCCAAGCATCCAGTGG No data
1122309674_1122309679 6 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309679 14:100786464-100786486 CATCCAGTGGCAGTGCCCCCGGG No data
1122309674_1122309687 27 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309687 14:100786485-100786507 GGCATGAGACCGGAGCCACAGGG No data
1122309674_1122309678 5 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309674 Original CRISPR GGTCCCCCATCCCACATCCC TGG (reversed) Intergenic