ID: 1122309678

View in Genome Browser
Species Human (GRCh38)
Location 14:100786463-100786485
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309669_1122309678 13 Left 1122309669 14:100786427-100786449 CCTGCATGCCAGGGATGTGGGAT No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data
1122309674_1122309678 5 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data
1122309662_1122309678 27 Left 1122309662 14:100786413-100786435 CCCCGAGTCTGTGTCCTGCATGC No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data
1122309664_1122309678 25 Left 1122309664 14:100786415-100786437 CCGAGTCTGTGTCCTGCATGCCA No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data
1122309663_1122309678 26 Left 1122309663 14:100786414-100786436 CCCGAGTCTGTGTCCTGCATGCC No data
Right 1122309678 14:100786463-100786485 GCATCCAGTGGCAGTGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309678 Original CRISPR GCATCCAGTGGCAGTGCCCC CGG Intergenic