ID: 1122309681

View in Genome Browser
Species Human (GRCh38)
Location 14:100786475-100786497
Sequence AGTGCCCCCGGGCATGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309676_1122309681 -4 Left 1122309676 14:100786456-100786478 CCTCCAAGCATCCAGTGGCAGTG No data
Right 1122309681 14:100786475-100786497 AGTGCCCCCGGGCATGAGACCGG No data
1122309669_1122309681 25 Left 1122309669 14:100786427-100786449 CCTGCATGCCAGGGATGTGGGAT No data
Right 1122309681 14:100786475-100786497 AGTGCCCCCGGGCATGAGACCGG No data
1122309677_1122309681 -7 Left 1122309677 14:100786459-100786481 CCAAGCATCCAGTGGCAGTGCCC No data
Right 1122309681 14:100786475-100786497 AGTGCCCCCGGGCATGAGACCGG No data
1122309674_1122309681 17 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309681 14:100786475-100786497 AGTGCCCCCGGGCATGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309681 Original CRISPR AGTGCCCCCGGGCATGAGAC CGG Intergenic