ID: 1122309686

View in Genome Browser
Species Human (GRCh38)
Location 14:100786484-100786506
Sequence GGGCATGAGACCGGAGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122309676_1122309686 5 Left 1122309676 14:100786456-100786478 CCTCCAAGCATCCAGTGGCAGTG No data
Right 1122309686 14:100786484-100786506 GGGCATGAGACCGGAGCCACAGG No data
1122309677_1122309686 2 Left 1122309677 14:100786459-100786481 CCAAGCATCCAGTGGCAGTGCCC No data
Right 1122309686 14:100786484-100786506 GGGCATGAGACCGGAGCCACAGG No data
1122309674_1122309686 26 Left 1122309674 14:100786435-100786457 CCAGGGATGTGGGATGGGGGACC No data
Right 1122309686 14:100786484-100786506 GGGCATGAGACCGGAGCCACAGG No data
1122309680_1122309686 -6 Left 1122309680 14:100786467-100786489 CCAGTGGCAGTGCCCCCGGGCAT No data
Right 1122309686 14:100786484-100786506 GGGCATGAGACCGGAGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122309686 Original CRISPR GGGCATGAGACCGGAGCCAC AGG Intergenic