ID: 1122310599

View in Genome Browser
Species Human (GRCh38)
Location 14:100791900-100791922
Sequence TGCCGTGTGCCCACTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122310599_1122310611 21 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310611 14:100791944-100791966 GGGGGCCAGGATGCCTCTAGAGG No data
1122310599_1122310610 8 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310610 14:100791931-100791953 GAAGTCAGGGGCTGGGGGCCAGG No data
1122310599_1122310606 1 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310606 14:100791924-100791946 TGGGCCAGAAGTCAGGGGCTGGG No data
1122310599_1122310604 -4 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310604 14:100791919-100791941 GGCAATGGGCCAGAAGTCAGGGG No data
1122310599_1122310605 0 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310605 14:100791923-100791945 ATGGGCCAGAAGTCAGGGGCTGG No data
1122310599_1122310602 -6 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310602 14:100791917-100791939 ACGGCAATGGGCCAGAAGTCAGG No data
1122310599_1122310603 -5 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310603 14:100791918-100791940 CGGCAATGGGCCAGAAGTCAGGG No data
1122310599_1122310608 3 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310608 14:100791926-100791948 GGCCAGAAGTCAGGGGCTGGGGG No data
1122310599_1122310607 2 Left 1122310599 14:100791900-100791922 CCTCTCTGAGTGGGCACACGGCA No data
Right 1122310607 14:100791925-100791947 GGGCCAGAAGTCAGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122310599 Original CRISPR TGCCGTGTGCCCACTCAGAG AGG (reversed) Intergenic
No off target data available for this crispr