ID: 1122311920

View in Genome Browser
Species Human (GRCh38)
Location 14:100802898-100802920
Sequence GCAATGCAGCAGCCAAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122311920_1122311930 18 Left 1122311920 14:100802898-100802920 CCTCGGCTTGGCTGCTGCATTGC No data
Right 1122311930 14:100802939-100802961 GAACACAGCTGGCTAAGTGTGGG No data
1122311920_1122311928 7 Left 1122311920 14:100802898-100802920 CCTCGGCTTGGCTGCTGCATTGC No data
Right 1122311928 14:100802928-100802950 TGCTGGAGGGAGAACACAGCTGG No data
1122311920_1122311929 17 Left 1122311920 14:100802898-100802920 CCTCGGCTTGGCTGCTGCATTGC No data
Right 1122311929 14:100802938-100802960 AGAACACAGCTGGCTAAGTGTGG No data
1122311920_1122311922 -7 Left 1122311920 14:100802898-100802920 CCTCGGCTTGGCTGCTGCATTGC No data
Right 1122311922 14:100802914-100802936 GCATTGCCCTGCCCTGCTGGAGG No data
1122311920_1122311923 -6 Left 1122311920 14:100802898-100802920 CCTCGGCTTGGCTGCTGCATTGC No data
Right 1122311923 14:100802915-100802937 CATTGCCCTGCCCTGCTGGAGGG No data
1122311920_1122311931 27 Left 1122311920 14:100802898-100802920 CCTCGGCTTGGCTGCTGCATTGC No data
Right 1122311931 14:100802948-100802970 TGGCTAAGTGTGGGTTTGCCAGG No data
1122311920_1122311921 -10 Left 1122311920 14:100802898-100802920 CCTCGGCTTGGCTGCTGCATTGC No data
Right 1122311921 14:100802911-100802933 GCTGCATTGCCCTGCCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122311920 Original CRISPR GCAATGCAGCAGCCAAGCCG AGG (reversed) Intergenic