ID: 1122311924

View in Genome Browser
Species Human (GRCh38)
Location 14:100802920-100802942
Sequence GTTCTCCCTCCAGCAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122311924_1122311931 5 Left 1122311924 14:100802920-100802942 CCCTGCCCTGCTGGAGGGAGAAC No data
Right 1122311931 14:100802948-100802970 TGGCTAAGTGTGGGTTTGCCAGG No data
1122311924_1122311930 -4 Left 1122311924 14:100802920-100802942 CCCTGCCCTGCTGGAGGGAGAAC No data
Right 1122311930 14:100802939-100802961 GAACACAGCTGGCTAAGTGTGGG No data
1122311924_1122311929 -5 Left 1122311924 14:100802920-100802942 CCCTGCCCTGCTGGAGGGAGAAC No data
Right 1122311929 14:100802938-100802960 AGAACACAGCTGGCTAAGTGTGG No data
1122311924_1122311932 11 Left 1122311924 14:100802920-100802942 CCCTGCCCTGCTGGAGGGAGAAC No data
Right 1122311932 14:100802954-100802976 AGTGTGGGTTTGCCAGGAGATGG No data
1122311924_1122311933 21 Left 1122311924 14:100802920-100802942 CCCTGCCCTGCTGGAGGGAGAAC No data
Right 1122311933 14:100802964-100802986 TGCCAGGAGATGGAAGAATGAGG No data
1122311924_1122311934 22 Left 1122311924 14:100802920-100802942 CCCTGCCCTGCTGGAGGGAGAAC No data
Right 1122311934 14:100802965-100802987 GCCAGGAGATGGAAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122311924 Original CRISPR GTTCTCCCTCCAGCAGGGCA GGG (reversed) Intergenic