ID: 1122311925

View in Genome Browser
Species Human (GRCh38)
Location 14:100802921-100802943
Sequence TGTTCTCCCTCCAGCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122311925_1122311932 10 Left 1122311925 14:100802921-100802943 CCTGCCCTGCTGGAGGGAGAACA No data
Right 1122311932 14:100802954-100802976 AGTGTGGGTTTGCCAGGAGATGG No data
1122311925_1122311931 4 Left 1122311925 14:100802921-100802943 CCTGCCCTGCTGGAGGGAGAACA No data
Right 1122311931 14:100802948-100802970 TGGCTAAGTGTGGGTTTGCCAGG No data
1122311925_1122311933 20 Left 1122311925 14:100802921-100802943 CCTGCCCTGCTGGAGGGAGAACA No data
Right 1122311933 14:100802964-100802986 TGCCAGGAGATGGAAGAATGAGG No data
1122311925_1122311929 -6 Left 1122311925 14:100802921-100802943 CCTGCCCTGCTGGAGGGAGAACA No data
Right 1122311929 14:100802938-100802960 AGAACACAGCTGGCTAAGTGTGG No data
1122311925_1122311930 -5 Left 1122311925 14:100802921-100802943 CCTGCCCTGCTGGAGGGAGAACA No data
Right 1122311930 14:100802939-100802961 GAACACAGCTGGCTAAGTGTGGG No data
1122311925_1122311934 21 Left 1122311925 14:100802921-100802943 CCTGCCCTGCTGGAGGGAGAACA No data
Right 1122311934 14:100802965-100802987 GCCAGGAGATGGAAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122311925 Original CRISPR TGTTCTCCCTCCAGCAGGGC AGG (reversed) Intergenic