ID: 1122311932

View in Genome Browser
Species Human (GRCh38)
Location 14:100802954-100802976
Sequence AGTGTGGGTTTGCCAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122311925_1122311932 10 Left 1122311925 14:100802921-100802943 CCTGCCCTGCTGGAGGGAGAACA No data
Right 1122311932 14:100802954-100802976 AGTGTGGGTTTGCCAGGAGATGG No data
1122311924_1122311932 11 Left 1122311924 14:100802920-100802942 CCCTGCCCTGCTGGAGGGAGAAC No data
Right 1122311932 14:100802954-100802976 AGTGTGGGTTTGCCAGGAGATGG No data
1122311927_1122311932 5 Left 1122311927 14:100802926-100802948 CCTGCTGGAGGGAGAACACAGCT No data
Right 1122311932 14:100802954-100802976 AGTGTGGGTTTGCCAGGAGATGG No data
1122311926_1122311932 6 Left 1122311926 14:100802925-100802947 CCCTGCTGGAGGGAGAACACAGC No data
Right 1122311932 14:100802954-100802976 AGTGTGGGTTTGCCAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122311932 Original CRISPR AGTGTGGGTTTGCCAGGAGA TGG Intergenic