ID: 1122312791

View in Genome Browser
Species Human (GRCh38)
Location 14:100807760-100807782
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122312791_1122312799 30 Left 1122312791 14:100807760-100807782 CCTGGAGGGGCTTTGGTACCCCG No data
Right 1122312799 14:100807813-100807835 CTGCATCAGCTCACTGCAGGAGG No data
1122312791_1122312798 27 Left 1122312791 14:100807760-100807782 CCTGGAGGGGCTTTGGTACCCCG No data
Right 1122312798 14:100807810-100807832 TCTCTGCATCAGCTCACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122312791 Original CRISPR CGGGGTACCAAAGCCCCTCC AGG (reversed) Intergenic
No off target data available for this crispr