ID: 1122314386

View in Genome Browser
Species Human (GRCh38)
Location 14:100817244-100817266
Sequence CCTGGCAGGGCGAAGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122314371_1122314386 27 Left 1122314371 14:100817194-100817216 CCTGTGGCATGAATATCAACTTT No data
Right 1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG No data
1122314377_1122314386 4 Left 1122314377 14:100817217-100817239 CCTGTTTTTGCAGGGGGGAAACC No data
Right 1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122314386 Original CRISPR CCTGGCAGGGCGAAGTGGGC AGG Intergenic
No off target data available for this crispr