ID: 1122314514

View in Genome Browser
Species Human (GRCh38)
Location 14:100817880-100817902
Sequence CAGCCCTTGTCAGCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122314502_1122314514 27 Left 1122314502 14:100817830-100817852 CCGGCCTGGGATTCCCAGGAAAG No data
Right 1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG No data
1122314504_1122314514 23 Left 1122314504 14:100817834-100817856 CCTGGGATTCCCAGGAAAGGCTG No data
Right 1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG No data
1122314508_1122314514 14 Left 1122314508 14:100817843-100817865 CCCAGGAAAGGCTGGTGGTGGAG No data
Right 1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG No data
1122314501_1122314514 28 Left 1122314501 14:100817829-100817851 CCCGGCCTGGGATTCCCAGGAAA No data
Right 1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG No data
1122314512_1122314514 -10 Left 1122314512 14:100817867-100817889 CCAGAGAGGCTCACAGCCCTTGT No data
Right 1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG No data
1122314500_1122314514 29 Left 1122314500 14:100817828-100817850 CCCCGGCCTGGGATTCCCAGGAA No data
Right 1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG No data
1122314509_1122314514 13 Left 1122314509 14:100817844-100817866 CCAGGAAAGGCTGGTGGTGGAGG No data
Right 1122314514 14:100817880-100817902 CAGCCCTTGTCAGCCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122314514 Original CRISPR CAGCCCTTGTCAGCCAGGCC TGG Intergenic
No off target data available for this crispr