ID: 1122316624

View in Genome Browser
Species Human (GRCh38)
Location 14:100829149-100829171
Sequence GTTTAAGTCTTTAGGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122316624_1122316632 2 Left 1122316624 14:100829149-100829171 CCCTCTTACCTAAAGACTTAAAC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1122316632 14:100829174-100829196 ATGCCCTAGTGAGGGGGCATTGG 0: 1
1: 0
2: 2
3: 12
4: 106
1122316624_1122316630 -4 Left 1122316624 14:100829149-100829171 CCCTCTTACCTAAAGACTTAAAC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1122316630 14:100829168-100829190 AAACCAATGCCCTAGTGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 114
1122316624_1122316627 -7 Left 1122316624 14:100829149-100829171 CCCTCTTACCTAAAGACTTAAAC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1122316627 14:100829165-100829187 CTTAAACCAATGCCCTAGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1122316624_1122316629 -5 Left 1122316624 14:100829149-100829171 CCCTCTTACCTAAAGACTTAAAC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1122316629 14:100829167-100829189 TAAACCAATGCCCTAGTGAGGGG 0: 1
1: 0
2: 0
3: 7
4: 72
1122316624_1122316633 3 Left 1122316624 14:100829149-100829171 CCCTCTTACCTAAAGACTTAAAC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1122316633 14:100829175-100829197 TGCCCTAGTGAGGGGGCATTGGG 0: 1
1: 0
2: 0
3: 10
4: 115
1122316624_1122316628 -6 Left 1122316624 14:100829149-100829171 CCCTCTTACCTAAAGACTTAAAC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1122316628 14:100829166-100829188 TTAAACCAATGCCCTAGTGAGGG 0: 1
1: 0
2: 3
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122316624 Original CRISPR GTTTAAGTCTTTAGGTAAGA GGG (reversed) Intergenic
906002752 1:42441175-42441197 GTTTAATTCTATAGATGAGATGG + Intronic
909662278 1:78097446-78097468 GGCTAAGTCTTTAGGGAAGTTGG - Intronic
910179224 1:84463178-84463200 GATTAAGTTTTTAGGATAGAAGG - Intergenic
910743577 1:90548572-90548594 GTATATGTCTTTTAGTAAGAAGG - Intergenic
912451494 1:109770289-109770311 GCTTAAGTTTTCAGGAAAGAAGG + Intronic
923633471 1:235671508-235671530 GGTTAATACTTTAGATAAGATGG + Intronic
1065148510 10:22797752-22797774 TTTTTAGTCTTTAAGAAAGAGGG + Intergenic
1066232778 10:33453792-33453814 GCTTAATTCTTTAGGTAGAAAGG - Intergenic
1067858864 10:49823152-49823174 ATTGAAGTATTTAGGAAAGAGGG + Intronic
1072890501 10:99319534-99319556 GATGGAGACTTTAGGTAAGATGG + Intergenic
1072941483 10:99768046-99768068 GTTTACGTCTTTCGGTAAACTGG + Intergenic
1077310923 11:1888836-1888858 GATGAAAACTTTAGGTAAGATGG - Intronic
1079871078 11:25798678-25798700 GTTGAAGTCTGAAGGTCAGAAGG + Intergenic
1079896254 11:26122215-26122237 CCTTAACTCTATAGGTAAGATGG - Intergenic
1080335369 11:31189430-31189452 GTTTCAGTCCTGAGATAAGAAGG - Intronic
1082566027 11:54678702-54678724 ATTTAACTCTATAGCTAAGAAGG - Intergenic
1083052267 11:59787909-59787931 ACTTCAGTCTTTAGGTAAGAGGG - Intronic
1083823430 11:65184857-65184879 GTTTAAGTCTTCCGTGAAGAAGG + Intronic
1086091463 11:83008905-83008927 GTTCAACTCCTTAGGTAGGATGG + Intronic
1087519419 11:99212219-99212241 GTATAAGTTTTTATGTAAAATGG - Intronic
1090571701 11:128054152-128054174 GTTTAAGAATTCAGGAAAGAGGG + Intergenic
1092522464 12:9288802-9288824 GTTTAAGACTTTAGGCACGGTGG - Intergenic
1097836798 12:64281396-64281418 TTTTATGTTTTTAGTTAAGACGG - Intronic
1099283061 12:80676940-80676962 GTTTAATTCTTAAGGTAATATGG + Intronic
1100708159 12:97224462-97224484 TTTTAAGTCTATAGGTTAGAAGG - Intergenic
1100931218 12:99611625-99611647 ATTTAAGTCTTCACATAAGATGG - Intronic
1102057930 12:109910685-109910707 GTTGCAGCTTTTAGGTAAGAGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1107283511 13:38763481-38763503 TTTTAAGTCTTTCTGAAAGAGGG - Intronic
1108834721 13:54528974-54528996 GTTTACTTCTTTAGAAAAGAAGG - Intergenic
1108964582 13:56281947-56281969 GATTATGTCTTTAGTTAAGAAGG + Intergenic
1110845949 13:80190308-80190330 GTTTAAGACTTTCACTAAGATGG - Intergenic
1113129354 13:107018292-107018314 GTATTAGGCTTTAGGGAAGAAGG + Intergenic
1113217080 13:108054697-108054719 GTTAGAATCTTTATGTAAGAAGG + Intergenic
1114284373 14:21226401-21226423 CTTTAAGTCCTTAGGTAGGCTGG - Intronic
1114890799 14:26920232-26920254 TTTTAAGTTTTTAGATAAGTTGG + Intergenic
1115261169 14:31455869-31455891 GGTTAATTCTTTAGATAGGATGG + Intronic
1116903691 14:50385225-50385247 TTTTAATTCCTTAGTTAAGATGG - Intronic
1118107410 14:62675689-62675711 GTTCAAGTCTATAGCTAAAAAGG - Intergenic
1122316624 14:100829149-100829171 GTTTAAGTCTTTAGGTAAGAGGG - Intergenic
1126836120 15:52667204-52667226 TTTTAAGTATTTAGGCAAAATGG - Intronic
1135815649 16:25630287-25630309 TTTTAAATCTGGAGGTAAGATGG - Intergenic
1136866533 16:33762044-33762066 GTGTAAGTCTTTACATAAAAAGG - Intergenic
1139161243 16:64512792-64512814 GAATAAGTCTTTAAGTCAGATGG - Intergenic
1139276180 16:65729666-65729688 GTTTGGGACTTTAGGTGAGAAGG - Intergenic
1203105627 16_KI270728v1_random:1354159-1354181 GTGTAAGTCTTTACATAAAAAGG + Intergenic
1203127887 16_KI270728v1_random:1608209-1608231 GTGTAAGTCTTTACATAAAAAGG - Intergenic
1147769674 17:42858834-42858856 GTTCAAGTCCTCAGGTCAGAGGG - Intergenic
1148739740 17:49886062-49886084 GGTTTTGTCTTTAGGGAAGAAGG + Intergenic
1149877602 17:60252654-60252676 TTTCAAATCTCTAGGTAAGAAGG + Intronic
1152479367 17:80539817-80539839 GTCTAAGTTTTAGGGTAAGAAGG + Intergenic
1155137794 18:23013625-23013647 GTTTAAGTCTCTGAGCAAGAAGG + Intronic
1156012978 18:32515356-32515378 GTATGAGTCTTTTGGTGAGAGGG - Intergenic
1156608998 18:38704034-38704056 GTTTCAGTCTTTAGGAATAAAGG - Intergenic
1159027722 18:63201263-63201285 ATTTAAGACTTTCTGTAAGATGG + Intronic
1159227643 18:65560532-65560554 GTAGATGTCTTTAGGTAATATGG - Intergenic
1159286065 18:66353837-66353859 TTTAAAGTATTTAGGTAGGAAGG - Intergenic
1159358062 18:67362427-67362449 TTATAAGTCTTTTGGAAAGAAGG + Intergenic
1159968815 18:74623860-74623882 GCTTGAGTGTTTGGGTAAGATGG + Intronic
1163569641 19:18073361-18073383 GTTTAACTCTGAAGGTAATAGGG - Intronic
1164412308 19:28016187-28016209 ATTTAAGTCTTTAACTTAGAAGG - Intergenic
1165611999 19:37162955-37162977 GTTTAAGTTTATAGGTACAAGGG - Intronic
928300430 2:30119296-30119318 GTTAGAGCCTTTGGGTAAGAGGG - Intergenic
928300695 2:30121537-30121559 GTTAGAGCCTTTGGGTAAGAGGG + Intergenic
929774930 2:44923740-44923762 GTTAAAGTCTCTTGGTATGAAGG - Intergenic
930102254 2:47612542-47612564 GTTTAATGTATTAGGTAAGACGG + Intergenic
931040932 2:58299098-58299120 GTTTAGATTCTTAGGTAAGATGG + Intergenic
932658607 2:73632277-73632299 TTTTAACTTTTTAGGTGAGAGGG - Intergenic
932665217 2:73692287-73692309 TTTTAACTTTTTAGGTGAGAGGG - Intergenic
933481853 2:82868134-82868156 GTTTATGCCATTAGGCAAGAAGG + Intergenic
934635224 2:95980627-95980649 GTGTAAGTCTTTACATAAAAAGG - Exonic
934798406 2:97124596-97124618 GTGTAAGTCTTTACATAAAAAGG + Exonic
934835023 2:97578885-97578907 GTGTAAGTCTTTACGTAAAAAGG - Exonic
937138750 2:119579141-119579163 GTTTAAATAATAAGGTAAGAGGG + Intronic
938171911 2:129086268-129086290 GATGAAGTCTCTAGGCAAGAAGG - Intergenic
942084687 2:172432974-172432996 ATTTAACTCTTTCGGTAGGATGG + Intronic
1169927447 20:10797603-10797625 GTTTAAGTCTTTTTATAAGCTGG + Intergenic
1173588056 20:44199725-44199747 ATGTAAGTCCTTAGTTAAGATGG + Intronic
1175158475 20:56990472-56990494 GTATAAGTCTTTTGCAAAGATGG - Intergenic
1177286229 21:19054419-19054441 GTTTCAGTCTGTAGATAACAAGG - Intergenic
1178014849 21:28332627-28332649 GTTTAAGTATTTAGGAGATATGG - Intergenic
1181547485 22:23610323-23610345 GTTTAAGCCTTTAGGGAAGTGGG + Intronic
951195493 3:19819018-19819040 GTTGAAATCTGTAAGTAAGATGG - Intergenic
954012217 3:47651356-47651378 GTTTAAGTCTTTATGCAAAGTGG - Intronic
955031221 3:55221425-55221447 TTTTTACTCTGTAGGTAAGATGG + Intergenic
956206806 3:66763138-66763160 CTGTAAGTCTTTAGCTAACAGGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
957212987 3:77284928-77284950 GTGTAATTATTTAGCTAAGAGGG + Intronic
957838836 3:85639075-85639097 GTTTAAATTTGTAGGTAATATGG + Intronic
964092830 3:152896111-152896133 ACCTAAGTTTTTAGGTAAGAAGG + Intergenic
964726753 3:159821565-159821587 GTATAAGTTCTTAGTTAAGATGG - Intronic
965396921 3:168171241-168171263 GTTTGAGTATTAAGGTAATATGG + Intergenic
967667153 3:192186365-192186387 GTCTAAGGCTTTATGCAAGATGG - Intronic
972074472 4:35067927-35067949 GTTTCAATATATAGGTAAGATGG + Intergenic
972163466 4:36254034-36254056 TTTTCAGTCTTTAGTTCAGATGG + Intergenic
972362953 4:38345738-38345760 GTATAAGTCTTCAGTTGAGAAGG + Intergenic
973874207 4:55199131-55199153 GATTGAGTCTTTAGGTATCATGG - Intergenic
974453618 4:62097388-62097410 TCTGAAGTCTTTCGGTAAGACGG - Intergenic
976471664 4:85436268-85436290 CTTTAAGTTTTTAGTAAAGACGG + Intergenic
977976739 4:103275091-103275113 TTTTAAGTCACTAGGTAAGGGGG + Intergenic
978181963 4:105809213-105809235 TTTTAAGTGTTTGGTTAAGATGG + Intronic
978288216 4:107104315-107104337 GTGTTAGTCCTGAGGTAAGATGG + Intronic
979882146 4:125973199-125973221 CTTTAAGACTGTAGGTATGAAGG - Intergenic
980342361 4:131567168-131567190 GTTCAAGTCTTTATTTAAGAAGG + Intergenic
981113446 4:140961107-140961129 GGTTAAATCTTTAGGAAACATGG + Intronic
981339504 4:143604360-143604382 GTTTAAGTTTTTAGAGAAAAAGG - Intronic
981986670 4:150865000-150865022 CTTCAAGTCCTTAGGAAAGATGG - Intronic
983964530 4:173793126-173793148 GTATAAGTTATGAGGTAAGAAGG - Intergenic
986265052 5:6183953-6183975 GATTAACTCTCCAGGTAAGAGGG - Intergenic
987177552 5:15330962-15330984 GTTTAAGTGCTTAGTTAAGATGG - Intergenic
991532008 5:67625715-67625737 GCATAAGTGTTTAGTTAAGATGG - Intergenic
993079981 5:83284223-83284245 GTTTAATTCTTCTGGTAAAAAGG + Intronic
996972890 5:129394617-129394639 TTTTGAGTTTTTAGTTAAGACGG - Intergenic
1006428615 6:33981727-33981749 GTGTGAGTCTTTGGGAAAGATGG - Intergenic
1009335517 6:62485134-62485156 GTTTATGTGTATATGTAAGAGGG + Intergenic
1009922827 6:70084066-70084088 GTTTAAATCTTTGTGTAAAAGGG - Intronic
1010741723 6:79514018-79514040 TTTTAACTTTTTAGATAAGATGG + Intronic
1012424057 6:99095080-99095102 GTTTAAATCTCCAGGTAAGTTGG - Intergenic
1014286094 6:119500094-119500116 CTTTAAGTCTTGAGGTTAGGTGG + Intergenic
1014591426 6:123276707-123276729 GTCTAAGCCATTAGATAAGAGGG - Intronic
1016188686 6:141232617-141232639 GTTTAAATTTTTAGGCAAAAGGG - Intergenic
1016354063 6:143198708-143198730 ATTTAAGCCATTAGGAAAGAGGG + Intronic
1022299972 7:29093889-29093911 GTTAAAGATTTTAGTTAAGAGGG + Intronic
1023068627 7:36404450-36404472 GTGTAAGTGCTTAGTTAAGATGG - Intronic
1024558827 7:50626953-50626975 GTTAAAGTCTTTAGTGAAGATGG - Exonic
1025502008 7:61313096-61313118 GTTTAAGGCCTATGGTAAGAAGG - Intergenic
1025516875 7:61659318-61659340 GTTTAAGGCCTATGGTAAGAAGG - Intergenic
1025541214 7:62088142-62088164 GTTTAAGGCCTATGGTAAGAAGG - Intergenic
1026364556 7:69634690-69634712 CTTTAAGTATTTCGGGAAGAGGG + Intronic
1030713686 7:112784658-112784680 GCTTAGGTCTATACGTAAGATGG - Exonic
1031640411 7:124156702-124156724 ATTTAAGTGTTTAGGCCAGAAGG - Intergenic
1032057410 7:128694885-128694907 ATTTCAGTCTTTAGTGAAGAAGG - Intergenic
1034910109 7:154989380-154989402 ATTCAAGTTATTAGGTAAGATGG - Intronic
1035331180 7:158098378-158098400 GTTTGACTCTGTAGGAAAGAGGG + Intronic
1039287885 8:36062254-36062276 GTTTCAGTCTTTGAGCAAGAAGG - Intergenic
1048966902 8:139621713-139621735 ACTTAAGTCTTCAGGAAAGAAGG + Intronic
1052045385 9:23788071-23788093 TTTTAAGACTGTAGGTAAGAAGG + Intronic
1055069940 9:72155742-72155764 GTTGCAGTATTTAGGTAAAATGG + Intronic
1056213794 9:84389842-84389864 GTTTAGGTGTTTAGGTGTGAAGG - Intergenic
1057108147 9:92440703-92440725 TTATAAGTATTTAGTTAAGAGGG + Intronic
1059949817 9:119450628-119450650 GTGTACATCTTTAGGTATGAAGG + Intergenic
1187599124 X:20807184-20807206 GTTCAAGGTTTTAGGTAACAAGG - Intergenic
1188062949 X:25623289-25623311 GTTTAATTCATTAGGTAAAGAGG + Intergenic
1188090447 X:25958015-25958037 TTTTGTGTCTTTAAGTAAGAAGG + Intergenic
1190005087 X:46727961-46727983 TATTAAGTCTATATGTAAGATGG + Intronic
1192234605 X:69287760-69287782 TTTTAAGTCTTTAAGTATAAGGG - Intergenic
1193276251 X:79591012-79591034 ATTTAAGGATTTAGGCAAGATGG - Intergenic
1194584345 X:95714726-95714748 GTTTAAGTCAATGGCTAAGAAGG + Intergenic
1196906432 X:120441455-120441477 GTTTTAGTTTGTAGGGAAGATGG - Intronic
1197162706 X:123342066-123342088 GTCTAGGTCTTTAGGAAATAAGG - Intronic
1198449622 X:136754199-136754221 TATTAAGTGTTCAGGTAAGAGGG + Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1199272851 X:145905375-145905397 GTTTAATCCTTTAGTTAACATGG - Intergenic
1199671973 X:150155194-150155216 TTTTAAGCCCTTTGGTAAGAGGG + Intergenic
1202585461 Y:26420530-26420552 GTGTAAGTCTTTACATAAAAAGG + Intergenic