ID: 1122316776

View in Genome Browser
Species Human (GRCh38)
Location 14:100830111-100830133
Sequence CTCTGGGCCAGAGGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122316776_1122316783 22 Left 1122316776 14:100830111-100830133 CCTTCTTCCCCTCTGGCCCAGAG 0: 1
1: 0
2: 7
3: 54
4: 505
Right 1122316783 14:100830156-100830178 TCAAACCAAATGTTTGACAATGG 0: 1
1: 0
2: 0
3: 49
4: 536
1122316776_1122316784 23 Left 1122316776 14:100830111-100830133 CCTTCTTCCCCTCTGGCCCAGAG 0: 1
1: 0
2: 7
3: 54
4: 505
Right 1122316784 14:100830157-100830179 CAAACCAAATGTTTGACAATGGG 0: 1
1: 0
2: 3
3: 57
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122316776 Original CRISPR CTCTGGGCCAGAGGGGAAGA AGG (reversed) Intergenic
900519003 1:3096657-3096679 CCCTGGACCAGCGAGGAAGACGG + Intronic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901491436 1:9598290-9598312 CTGTTGGGCAGAGGGGAAGCAGG + Intronic
904034007 1:27549527-27549549 CTCTGGGCGAGAGGCTGAGAGGG + Exonic
904401984 1:30262834-30262856 CTCAGGGGCACAGGGAAAGAAGG + Intergenic
904603537 1:31686390-31686412 CTCATGTCCAGAGAGGAAGAGGG + Intronic
904750308 1:32737673-32737695 CTTTAGGCCAGGGGGCAAGAGGG + Intergenic
905254470 1:36671310-36671332 CTCTGGGCCAGTGGGGCAGCAGG - Intergenic
905319810 1:37107932-37107954 CTCTGGGGCAGAGAGCATGAGGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906528450 1:46509895-46509917 CTCTAGGCCAGCTGGGATGAGGG + Intronic
906529754 1:46517041-46517063 CTCTGGAGCACCGGGGAAGAAGG - Intergenic
907002257 1:50873352-50873374 CCCAGGGCCATAGGGGAAAAAGG - Intronic
907267620 1:53272424-53272446 CTGGGGGGCAGAGGGGGAGAGGG - Intronic
907969676 1:59368661-59368683 GTATGGGCCAGAGAGGAGGAGGG + Intronic
908828753 1:68158518-68158540 CTCTGGGCCAAACCGGAAGGAGG + Intronic
909165620 1:72220430-72220452 CTTTGTGCCAGAAAGGAAGAGGG - Intronic
910103758 1:83607727-83607749 CTCTGGAGGAGAGGGTAAGATGG + Intergenic
912260612 1:108108551-108108573 CTCTGGGAGAGAGGGGAGGAGGG - Intergenic
912570301 1:110616358-110616380 CTGTGGGACAGCGGGGTAGAGGG + Intronic
912977854 1:114346259-114346281 CCCTGGGCCAGGAGGGAAGGGGG - Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
914883863 1:151569269-151569291 CTCTAGTCCAAAGGGGAACATGG + Intronic
914913308 1:151803312-151803334 CCCTGGGCCAGGCTGGAAGAGGG - Intronic
915368071 1:155326448-155326470 CACTGGGGCAGAGAGGAGGAAGG - Intronic
915478475 1:156168888-156168910 CTGGGAGCCACAGGGGAAGAGGG + Intronic
915491221 1:156251003-156251025 ATGGGGGGCAGAGGGGAAGATGG + Intronic
915963084 1:160283435-160283457 CTATGGGCCAGAGGGGAATGTGG - Intronic
915966559 1:160314046-160314068 CTCTTGGCGAGGGTGGAAGACGG + Exonic
915977491 1:160400641-160400663 CTGGGGGCCAGGGGGGAATAGGG - Exonic
917871676 1:179247891-179247913 CTCGGGGACAGAGGGGTAGTCGG + Intergenic
918238491 1:182601882-182601904 ATCAGGGCTAGAGGGGAGGAAGG - Intronic
918406215 1:184214043-184214065 CTCTGGGCCTGAGGAGGGGAGGG - Intergenic
919447833 1:197731635-197731657 CCCTGGGCCACAGTGGAAGAAGG + Intronic
919567695 1:199209530-199209552 GACTGGGCAAGAGGGGAATATGG - Intergenic
919751034 1:201038381-201038403 CACTGGGTCAGAAGGGAAGGAGG + Intergenic
920182921 1:204143592-204143614 CCCTGGGGCAGAGGAGCAGAAGG - Intronic
920412149 1:205770675-205770697 CACAGGGCCACAGTGGAAGATGG + Intronic
920449740 1:206051005-206051027 CTCAGGGTGAGAGGCGAAGAGGG - Intronic
921118391 1:212115708-212115730 CCCTGGGCCACATTGGAAGAAGG + Intergenic
921259128 1:213369951-213369973 CTCTAGGCCAGCGTGTAAGATGG + Intergenic
921480319 1:215657674-215657696 TTCTGGGACCCAGGGGAAGAGGG + Intronic
921688639 1:218121310-218121332 CTCTGGGCCACATTGGAAGAAGG - Intergenic
922178471 1:223215308-223215330 CTCTGGCCCAGTGGGAAATAAGG - Intergenic
922200085 1:223393881-223393903 CCCTGGGCCAGAGGGTAATGCGG - Exonic
922222381 1:223618562-223618584 CTCTGGGACAGAGTGGCTGATGG - Intronic
922791471 1:228313593-228313615 CTCTGCACAAGAGGGTAAGAAGG - Intronic
923607438 1:235457185-235457207 CCCTGGTCCTGAGGGGTAGATGG - Intronic
924048985 1:240061284-240061306 CCTGGGGCCAGAGGGGAACAGGG + Intronic
924697737 1:246418305-246418327 CTCTGTGGCAGAGGGGGACAAGG - Intronic
924726992 1:246680250-246680272 ATCAGGGCCAGAGGAGCAGAGGG + Intergenic
924863428 1:247951765-247951787 CTCTGGGACAGAGGGAAAATAGG + Intronic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1063139799 10:3245778-3245800 CTAAGGGCAAGAGGAGAAGATGG + Intergenic
1064014822 10:11763587-11763609 GGCTGGGCCAGAGGGGAAGGTGG - Exonic
1064017534 10:11784122-11784144 CTCAGGGCCTGAGGGGAGGTCGG - Intergenic
1065248366 10:23783113-23783135 CCCTGGGCCACACTGGAAGAAGG + Intronic
1065774560 10:29107397-29107419 CTCAGTGCCAGAGAGGAAGCTGG + Intergenic
1067224944 10:44369480-44369502 ATCTGGACCAATGGGGAAGAGGG + Intergenic
1067486633 10:46656702-46656724 CCCTGGGCCACAACGGAAGAAGG + Intergenic
1067608118 10:47684960-47684982 CCCTGGGCCACAACGGAAGAAGG - Intergenic
1067831885 10:49615173-49615195 CTCTGGGCCAGAGCAAAAGGAGG + Intronic
1067858857 10:49822995-49823017 CCCTGTGCTAGAGGGGAAAAAGG + Intronic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1069589686 10:69634140-69634162 CTCTGGGCCACAGAGGGAGGAGG + Intergenic
1069991076 10:72316592-72316614 AACTGGGCCAGAGGAGAGGAAGG - Intergenic
1070555878 10:77527443-77527465 CACAGGGGGAGAGGGGAAGAAGG + Intronic
1070846810 10:79529608-79529630 CTCTGGGGCCTATGGGAAGATGG - Intergenic
1070926989 10:80230659-80230681 CTCTGGGGCCTATGGGAAGATGG + Intergenic
1071499775 10:86195076-86195098 CTCTGGGCCAGACTTGAAGCGGG - Intronic
1071623715 10:87146670-87146692 CCCTGGGCCACAATGGAAGAAGG - Intronic
1071792150 10:88966161-88966183 CACTTGGACAGAGGGTAAGAAGG + Intronic
1071957913 10:90779213-90779235 CTCTGCTCCAAAGGGGGAGAAGG - Intronic
1072488887 10:95884042-95884064 CTCTTGGCCACAGGAGAAAATGG - Intronic
1073118600 10:101107805-101107827 CTCTTGGCCAGATAGGAAGGGGG + Intronic
1073207969 10:101778688-101778710 CTCTGGGGGAGAGGAGCAGATGG + Intronic
1073321183 10:102617193-102617215 CTCTGGGACAGTGGGGACTATGG - Intronic
1073438281 10:103535701-103535723 CTCTGGCCCAAGGGGGCAGAAGG + Intronic
1074171930 10:110949006-110949028 CTTTGGGCCACAATGGAAGAAGG - Intronic
1075119097 10:119651461-119651483 CTCGCTGCCAGAGGGGAAGGAGG - Exonic
1075122952 10:119677594-119677616 CTCTGGACTGGAGGGGTAGATGG + Exonic
1075292364 10:121241455-121241477 CTCTAGGCCAGTGTGGTAGAAGG - Intergenic
1075541641 10:123318731-123318753 CTCTGAGTCAGAGGAGAAGGGGG + Intergenic
1075934536 10:126328082-126328104 CTAGGGGCCAGCAGGGAAGATGG - Intronic
1076555195 10:131316860-131316882 TGCTGGGGCAGAGGGGAAGGGGG - Intergenic
1076668264 10:132104985-132105007 CTCTGGGCCCCAGGGGAGGCAGG - Intronic
1076734295 10:132451880-132451902 TTCAGGGCCAGAGGGGAAGGTGG + Intergenic
1076897910 10:133323152-133323174 CACAGGGCCAGAGAGGAAGCAGG - Intronic
1077269590 11:1669224-1669246 CTGTGGGGCACACGGGAAGAGGG + Intergenic
1077907853 11:6547656-6547678 CCCTGGCCCAGGTGGGAAGATGG + Exonic
1078480200 11:11668790-11668812 CTCTGGGACCATGGGGAAGATGG + Intergenic
1078507173 11:11960925-11960947 CTCTGGGCCTGTGGGGAGGGAGG - Intergenic
1078533714 11:12156655-12156677 ACCTGGGCCAGGTGGGAAGATGG + Intronic
1079007282 11:16800846-16800868 ATCTGGGGCTGAGGGGGAGAAGG + Intronic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1080639821 11:34152215-34152237 CTCTAGGGCAGAGGAGATGAGGG + Exonic
1081184293 11:40022967-40022989 ATCTGGGCCAGTAGGGAAAATGG + Intergenic
1081842470 11:46212811-46212833 CTCTGGGGCAAAGGGAAGGAAGG - Intergenic
1081927988 11:46846402-46846424 GTCTGGTCCAGAGGGAAACACGG - Intergenic
1082009064 11:47438219-47438241 CCCTGGGGCAGAGGAGGAGAGGG - Intronic
1083443006 11:62689393-62689415 CTATGGGCCAGAGAGGAGGAGGG - Intronic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1083896637 11:65623422-65623444 CAGTGGGGCAGTGGGGAAGATGG - Intronic
1084018614 11:66403150-66403172 TTTTGGGGCAGAGGAGAAGAGGG - Intergenic
1084264063 11:67995989-67996011 CTAAGAGCCAGGGGGGAAGAGGG + Intronic
1085026848 11:73241294-73241316 CTCTGGGGCAAAGGGGAGGGTGG + Intergenic
1085040444 11:73323634-73323656 GTCCAGGCCAGAGGGGAGGAGGG - Intronic
1085127999 11:74014999-74015021 GTCTAGGCTAGAAGGGAAGAAGG + Intronic
1085534033 11:77207486-77207508 CTGGGGGAGAGAGGGGAAGAGGG + Intronic
1085636203 11:78161387-78161409 GCCTGGGACAGAGGGGAAGATGG - Intergenic
1085717954 11:78889737-78889759 CTCTGGGCCAAAGAGGAGCAAGG + Intronic
1086272046 11:85079511-85079533 ATCTTGGCCAGAGGGGGATAAGG - Intronic
1088275816 11:108084054-108084076 CCCTGGGCCACACTGGAAGAAGG - Intronic
1088597044 11:111448582-111448604 CTCTGAGCCACAGGGGAAACAGG - Intronic
1088917910 11:114241005-114241027 CTCTGGGCCAGGAGGAAACATGG - Intronic
1089460806 11:118652291-118652313 CTCTGGGCCAGGAAGGTAGAGGG + Intronic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1089681036 11:120119152-120119174 CTATAGTCCAGAGGAGAAGAAGG + Intronic
1089808628 11:121113998-121114020 TTCTGAGCCAGAGGGACAGAAGG + Intronic
1090912733 11:131135573-131135595 CTCTGGGCCAAAGGGGACAGGGG + Intergenic
1090981402 11:131725653-131725675 CACTGGGTCAGAGAGGAAAACGG + Intronic
1091132890 11:133161167-133161189 CTTTGGGACTGAGGGGAAGTTGG + Intronic
1091250394 11:134139479-134139501 GCCTGGGGAAGAGGGGAAGATGG + Intronic
1091307044 11:134542940-134542962 CTGTGGGTCAGAGGGTAAGGGGG + Intergenic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091653351 12:2325848-2325870 CCCTAGGCCAGGGAGGAAGAGGG + Intronic
1092245939 12:6864219-6864241 CATGGGGCCAGTGGGGAAGAAGG + Intronic
1092538025 12:9404818-9404840 CTAAGAGCCAGAGGGGAAGAGGG - Intergenic
1092538598 12:9406457-9406479 CTAAGAGCCAGGGGGGAAGAGGG - Intergenic
1093261978 12:16950166-16950188 CTCTGCCCAAGAGGGGCAGAGGG + Intergenic
1094242293 12:28242515-28242537 CTCAGGGCCAGATGGGAAAGGGG + Intronic
1094250407 12:28353607-28353629 CTCTAGGAGAGAGGGGTAGATGG + Intronic
1094356228 12:29580596-29580618 GTTTGGAACAGAGGGGAAGATGG + Intronic
1094514736 12:31119996-31120018 CTAAGAGCCAGAGGTGAAGAGGG - Intergenic
1095188347 12:39227445-39227467 CGCTGGGCCACAGGGAAAAATGG + Intergenic
1095939538 12:47717085-47717107 CTCAGAGCCAGAGGGAAAGGGGG + Intronic
1096242378 12:49966265-49966287 CTCAGGCCCAGAGGAGAGGACGG - Intergenic
1096843113 12:54391047-54391069 GCCTGGGAAAGAGGGGAAGAGGG + Intronic
1097868961 12:64584320-64584342 CTTTTGCCCAGAGGGGAAGAGGG + Intergenic
1097998139 12:65912775-65912797 CTGTGGGCCAGAGAGGAAGAGGG - Intronic
1098903342 12:76135464-76135486 CCCTGGGCCACACTGGAAGAAGG - Intergenic
1099278812 12:80615618-80615640 CTTTGGGGCAGGGGTGAAGAAGG + Intronic
1101372511 12:104142105-104142127 CTGTGTACCAGAGTGGAAGAGGG - Intergenic
1102308308 12:111823552-111823574 CGCTGGGCCAGGGGGGTGGAGGG + Intergenic
1103054078 12:117804940-117804962 CTCTGGGCAGCAGGGAAAGATGG - Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1104003217 12:124873690-124873712 CCCTGGGGCTGAGGGGAGGAGGG - Intronic
1104914008 12:132255146-132255168 CTCAGGTCCTGATGGGAAGAGGG + Intronic
1107940457 13:45377490-45377512 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107940595 13:45377886-45377908 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941070 13:45380116-45380138 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941095 13:45380194-45380216 CTAAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941184 13:45380429-45380451 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941572 13:45381812-45381834 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1107941714 13:45382208-45382230 CTGAGAGCCAGGGGGGAAGAGGG + Intergenic
1108053045 13:46464221-46464243 CTGAGAGCCAGGGGGGAAGAGGG - Intergenic
1108053103 13:46464377-46464399 CTCAGAGCCAGGGGGGGAGAGGG - Intergenic
1108514295 13:51183991-51184013 GCCTTGGCCAGAGAGGAAGAAGG - Intergenic
1108872838 13:55007806-55007828 CTCTGGTGCAGAGGGAAAGTAGG - Intergenic
1109537509 13:63739135-63739157 CTAAGAGCCAGGGGGGAAGAGGG + Intergenic
1109537944 13:63741023-63741045 CTAAGAGCCAGGGGGGAAGAGGG + Intergenic
1109538073 13:63741420-63741442 CTAAGAGCCAGTGGGGAAGAGGG + Intergenic
1109538324 13:63742213-63742235 CTAAGAGCCAGGGGGGAAGAGGG + Intergenic
1109545515 13:63837559-63837581 CTAAGAGCCAGGGGGGAAGAGGG - Intergenic
1109545640 13:63837956-63837978 CTAAGAGCCAGGGGGGAAGAGGG - Intergenic
1109546345 13:63840909-63840931 CTAAGAGCCAGGGGGGAAGAGGG - Intergenic
1109546670 13:63842207-63842229 CTAAGAGCCAGGGGGGAAGAGGG - Intergenic
1109547140 13:63844251-63844273 CTATGAGCCAGGGGGGATGAGGG - Intergenic
1110591928 13:77273156-77273178 CTCAGGGAAAGATGGGAAGAAGG + Intronic
1110721272 13:78765030-78765052 CTCGGGGCTAGTGGGGAAGAAGG - Intergenic
1110892474 13:80707771-80707793 CTAAGAGCCAGGGGGGAAGAGGG - Intergenic
1111639278 13:90947182-90947204 CCCTGGGCCAGAAGGGAAACTGG + Intergenic
1112103782 13:96218392-96218414 CTCTGGGGCAGAGAGGAGGGTGG + Intronic
1113887714 13:113669820-113669842 GGCTGGGCCAGAGGGCACGAGGG + Intronic
1113905391 13:113817209-113817231 CTCTGGGCTGGAGAGGAGGAAGG - Intergenic
1114007700 14:18332560-18332582 CCTGGGCCCAGAGGGGAAGAGGG - Intergenic
1115607295 14:35016504-35016526 ATCTTGGCCAGAGGAGATGATGG - Intronic
1118316348 14:64728420-64728442 CCCTGAGCCAGTGGGGCAGAGGG - Intronic
1118770365 14:68938885-68938907 CTCTGGCCAAGAGGAGGAGATGG + Intronic
1119215697 14:72867491-72867513 CTATCGGCCAGAGAGGGAGAAGG - Intronic
1119335470 14:73829862-73829884 GGCTGGGCCAGAGAGGCAGAGGG - Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120284945 14:82488112-82488134 CTCTGTGCTAGAGGGGAAACAGG - Intergenic
1120708999 14:87773850-87773872 ATCTGGGCCAGAGGGAGAGAAGG - Intergenic
1122316776 14:100830111-100830133 CTCTGGGCCAGAGGGGAAGAAGG - Intergenic
1122489631 14:102105468-102105490 ACCTGGGTCAGAGTGGAAGAAGG + Intronic
1122834818 14:104425454-104425476 CTTTGGCCTAGTGGGGAAGAGGG + Intergenic
1122993620 14:105250543-105250565 CTTTGGGCAGGAGGGGATGACGG + Exonic
1125677258 15:41509081-41509103 CTCTGGGCTGATGGGGAAGATGG - Exonic
1126288794 15:47047529-47047551 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1127537239 15:59901245-59901267 CTATGGGACAAAAGGGAAGAGGG - Intergenic
1127772090 15:62240666-62240688 CTGTGGGCCATATGGAAAGAGGG + Intergenic
1128691730 15:69729569-69729591 CTCTGGGCCAGACATCAAGATGG + Intergenic
1128744532 15:70104073-70104095 CTGTGGCTCAGAGGGGAGGAAGG + Intergenic
1128951172 15:71883692-71883714 TTCTGGGCCAAAGGGAAACAAGG - Exonic
1129754443 15:78088625-78088647 CTCTGGGCCCCAGGTGGAGAAGG + Intronic
1131050692 15:89345999-89346021 GTCTGGCCCAGGGTGGAAGAGGG + Intergenic
1131746823 15:95457675-95457697 CACTGGGCCTCCGGGGAAGAGGG - Intergenic
1132830655 16:1926491-1926513 CTCTCGGCCAGAGGGGTGGGGGG - Intergenic
1132882810 16:2169963-2169985 TTCCAGGCCAGAGGGGAGGAAGG + Intronic
1132933738 16:2471139-2471161 GGCTGGGCCAGCGGGGAAGGGGG - Intergenic
1132948683 16:2547804-2547826 CTCTGAGCCCCAGGGGCAGAAGG + Intronic
1132965904 16:2654323-2654345 CTCTGAGCCCCAGGGGCAGAAGG - Intergenic
1133427666 16:5706818-5706840 CACTGGGGCAGGGGGCAAGAGGG + Intergenic
1134231131 16:12431229-12431251 GTCTGGGCAAAGGGGGAAGAGGG + Intronic
1134334205 16:13281116-13281138 CTATGAGCCAGAGATGAAGATGG + Intergenic
1134536369 16:15029866-15029888 GTCTGGGGCCGAGGGGATGAGGG + Intronic
1134685654 16:16156444-16156466 CTCTCGGCCAGGGGGGCACATGG - Intronic
1135359202 16:21796893-21796915 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135457754 16:22613330-22613352 ATGTGGGGCAGAGGGGGAGAGGG + Intergenic
1135736953 16:24939465-24939487 CTCTGGGCCAGCGGGCACCACGG + Exonic
1135877298 16:26214774-26214796 CTCTGTTACAGAGGAGAAGAAGG - Intergenic
1136021762 16:27445076-27445098 GTCTGGGGTAGAGTGGAAGAGGG - Intronic
1136023520 16:27455363-27455385 CTCCAGGTCAGAGGAGAAGAGGG + Intergenic
1136547761 16:30965253-30965275 CTCTGTGTCAGAGGCCAAGAAGG - Exonic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1138493939 16:57395592-57395614 CTCTGGGCCAAAGGGCCAGTGGG + Intergenic
1138502104 16:57453017-57453039 CTCTGAGCTAGACTGGAAGAAGG - Intronic
1139277171 16:65738720-65738742 GTCTGGCCCAGAGGGAAAGTGGG + Intergenic
1139434605 16:66928770-66928792 CTCTGGGCAATAGGGGCTGATGG + Intergenic
1139589529 16:67925862-67925884 CTCTGTGGCAGTGGGGAAGGGGG + Intronic
1141148277 16:81547156-81547178 ATCTGGGGCAGAGGAGGAGAGGG + Intronic
1141280427 16:82626224-82626246 CTTTGGGACTGAGGGTAAGAGGG - Intergenic
1141603943 16:85142525-85142547 CTGTGGGGGAGAGGGGAATAAGG - Intergenic
1141690067 16:85591592-85591614 CTCAGGGTCAGAGGGGAGGCTGG - Intergenic
1141717045 16:85732879-85732901 CTCTGGGGCCGACAGGAAGACGG + Intronic
1141768183 16:86072368-86072390 GTCTGGGACAGAGGGACAGAGGG - Intergenic
1142116262 16:88357607-88357629 GGCTGAGACAGAGGGGAAGAGGG + Intergenic
1142419612 16:89962195-89962217 CCGTGGCCCAGAGGAGAAGAGGG - Intronic
1143863672 17:9908874-9908896 CTCCAGGCCAGAGGGCAGGAGGG - Intergenic
1144090048 17:11848010-11848032 CTCTGGGCTTGAGGAGAAAAGGG - Intronic
1144420587 17:15094352-15094374 CCCTGGGCCACATTGGAAGAAGG + Intergenic
1145212033 17:21020965-21020987 CTGTGGGCCTTAGGGGAAGGTGG + Intronic
1145904845 17:28510660-28510682 CTCTGGGCCTGCGTGGAGGAGGG - Intronic
1146160538 17:30557154-30557176 CCCTGGGCCAGACTGGAACATGG + Exonic
1146449228 17:32959189-32959211 GTCTGGGCGACAGGGCAAGATGG + Intergenic
1146559777 17:33858123-33858145 AACTGGCCCAGAGTGGAAGATGG - Intronic
1146615711 17:34355789-34355811 CTCTGGGCCTGAGGGGCAGAAGG + Intergenic
1146709998 17:35032721-35032743 GTCTGGGTCAGAAGAGAAGAAGG + Intronic
1146988556 17:37245675-37245697 CTTTGGGCCAGAAATGAAGAAGG - Intronic
1147420981 17:40322085-40322107 CTCTGGGCCAGTGGGGAGTCTGG + Intronic
1147512675 17:41084696-41084718 CTGTGGGCCAGTGGTGAAGGGGG - Exonic
1147514868 17:41106043-41106065 CTGTGGGCCAGTGGTGAAGGGGG - Exonic
1147768177 17:42850791-42850813 CTGGGGGCCAGAGGGCAAGGGGG + Intergenic
1148246449 17:46034082-46034104 CTCTTGGTCAGAAGAGAAGAGGG + Intronic
1148737315 17:49872152-49872174 ATCAGGGCCAGAGGGGAGGGAGG + Intergenic
1148835592 17:50464106-50464128 CTCGGGGTCAGAGGAGAAAAGGG + Intronic
1149561060 17:57608273-57608295 CCCAGGGCCAGAGGCCAAGATGG - Intronic
1149580622 17:57748119-57748141 CTCAGAACCAGAGGGGAGGACGG + Intergenic
1150387375 17:64772961-64772983 CTCTGGGGCACAGGGGCATAGGG - Intergenic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1152322035 17:79613089-79613111 CTGTGTGCCCGAGTGGAAGAGGG + Intergenic
1152586422 17:81191425-81191447 CTCTGAGCCACAGGGGAGCAAGG + Intronic
1154348086 18:13560460-13560482 CTCTGTGCCAGTGGGGATGACGG + Intronic
1154529761 18:15331403-15331425 CCTGGGCCCAGAGGGGAAGAGGG + Intergenic
1156448892 18:37255337-37255359 ATCTGGGGCAGAGGGAAAGAGGG - Intronic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1157246332 18:46058081-46058103 CTCTGGGTCAGAGGAAGAGATGG + Intronic
1157564131 18:48668341-48668363 GCCTGGGCCATAGGGGAGGAGGG - Intronic
1157594629 18:48857087-48857109 CACTGGGCCAGTGGAGAAGAGGG + Intronic
1158434710 18:57427903-57427925 CTCCGGGCTTGCGGGGAAGAAGG - Intergenic
1158749555 18:60243239-60243261 CTGGGGGCCAGACGGGAAGCAGG - Intergenic
1159545989 18:69839713-69839735 CCCTGGGAGAGAGGGGAAGGAGG + Intronic
1159704965 18:71675068-71675090 TTCTGAGCCGGAGGGGCAGAAGG + Intergenic
1160006969 18:75075009-75075031 CTCCGGGCCAGAAGGGAGGCTGG + Intergenic
1160154134 18:76420315-76420337 TTTTGGGCCAGAGGGTGAGAAGG - Intronic
1160388893 18:78515436-78515458 CTCTGAGCCAGAAGGGAATGTGG - Intergenic
1160391236 18:78534843-78534865 GGCAGGGCCAGAGGGGAAGGGGG + Intergenic
1160497532 18:79384014-79384036 GGCTGGGGCAGAGGGGAACAGGG - Intergenic
1161416946 19:4152684-4152706 CCTAGAGCCAGAGGGGAAGAGGG + Intergenic
1162646663 19:12054985-12055007 CTCAGGGCAGGAGGGGAACAAGG + Intergenic
1163326632 19:16607794-16607816 CTCTGAGCCACATTGGAAGAAGG - Intronic
1163547543 19:17948715-17948737 CACTGGGCCAGTGGGGGCGATGG + Intergenic
1163633363 19:18427875-18427897 CTGTGGGCCAAAGGGGAAGATGG - Intronic
1164182205 19:22829310-22829332 GTCTGGGCCACAGAGCAAGACGG - Intergenic
1164308918 19:24029617-24029639 TTCTGGGCCTGAGGGCAGGAAGG + Intergenic
1164414833 19:28038324-28038346 CCCAGGGCCAGAGGGCAAGGGGG - Intergenic
1165256919 19:34582526-34582548 CCCTGGGCCACACTGGAAGAAGG + Intergenic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167612428 19:50513941-50513963 CGCTGGGCCTGCGGGGAAGGGGG - Intronic
1168323787 19:55526448-55526470 CTCTGGGCCTGAGGCCAAGGAGG + Intergenic
925109588 2:1322657-1322679 CTCTGCACCAGAAGGGTAGAAGG - Intronic
925194667 2:1913447-1913469 CTCTGGGACAGGGAGGAAGGGGG - Intronic
925257442 2:2502308-2502330 CTCTGGGGGAGCGAGGAAGAGGG - Intergenic
925355526 2:3238539-3238561 CTCTGGGCCACAGTGGCAGTGGG - Intronic
925658883 2:6181467-6181489 CTCTTGGGAAGAGAGGAAGAAGG - Intergenic
926242928 2:11101775-11101797 ATCAGGGGCTGAGGGGAAGAAGG + Intergenic
927119328 2:19940627-19940649 ATGTGAGGCAGAGGGGAAGAGGG - Intronic
927583525 2:24277754-24277776 CCCTGGGCCACATGGAAAGAGGG + Intronic
927714668 2:25343603-25343625 CTCTGGGCCGGTGGGGACCATGG - Intergenic
927890283 2:26743849-26743871 CTCTAGGTCTGAGGGGAAGGAGG - Intergenic
927940709 2:27101401-27101423 CCCGGGCCCAGAGGGGAAGCTGG - Exonic
927940728 2:27101452-27101474 CCCGGGCCCAGAGGGGAAGCTGG - Exonic
928087863 2:28356872-28356894 ATCTGGGCCACAGGGAGAGATGG + Intergenic
929428811 2:41870004-41870026 GTCTGGGGCAGAGGGGACGGTGG - Intergenic
929590214 2:43140619-43140641 CGCTGGTTCAGTGGGGAAGAGGG - Intergenic
929673126 2:43895236-43895258 CTCTTGGTGAGATGGGAAGAGGG - Intronic
931248559 2:60510831-60510853 CTCAGGGCCTGTGGGGAAAATGG - Intronic
931667427 2:64619424-64619446 CCCTGGGCCACATGGGAAGAAGG - Intergenic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
934889982 2:98058936-98058958 ATCTGGGCCCCAGGGAAAGAAGG - Intergenic
935162599 2:100542198-100542220 ATTTGGGCAAGAGAGGAAGAAGG + Intergenic
937097612 2:119245900-119245922 CACTGTGCAAGTGGGGAAGAGGG - Exonic
937138414 2:119575982-119576004 TTCTGGGACAGAGGTGAAGGTGG + Intronic
937340820 2:121089305-121089327 CTCTGGCCCAGAGTGGGACACGG + Intergenic
937814961 2:126241157-126241179 GTATGGGCCAGAGGAGAGGAGGG - Intergenic
938008724 2:127811137-127811159 CGGTGGCCCATAGGGGAAGATGG - Exonic
938528855 2:132162843-132162865 CCTGGGCCCAGAGGGGAAGAGGG + Intronic
938791477 2:134680061-134680083 CTCTGGGCCAGGTGGCATGATGG + Intronic
939994325 2:148906126-148906148 CTTGGGGCCAGAGGGAAAAAGGG + Intronic
940201786 2:151159411-151159433 CTTTGGGCCAGAGAGGACCAGGG + Intergenic
940725520 2:157331603-157331625 CCCTGGGCCACACTGGAAGAAGG + Intergenic
940740348 2:157500436-157500458 CTGTGGCCCAATGGGGAAGAGGG + Intergenic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
942669984 2:178364762-178364784 GTCTAGGCTAGAGAGGAAGATGG + Intronic
942774097 2:179559920-179559942 CTGTGGGAGAGAGGGGAATATGG - Intronic
947541871 2:230985442-230985464 CACTGGGGGAGAGGGGAGGAAGG + Intergenic
947872999 2:233450037-233450059 CTCTGAGTCAGAGGAGAAGATGG + Exonic
948342732 2:237268385-237268407 CTCTGGGCACCAGGGAAAGAGGG - Intergenic
948479042 2:238239250-238239272 CTCTGGGCCCGAGGGTGGGAGGG + Exonic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948852193 2:240713957-240713979 CTCTGAGCCACAGGGGAACCAGG + Exonic
948993345 2:241565394-241565416 CAGTGGGCCTGAGGGGCAGAAGG - Intronic
1170516631 20:17136957-17136979 AACTTGGCCAGAGGGGAAGGTGG - Intergenic
1170761244 20:19253403-19253425 CTCAGGCCCTGAGGGGAACAGGG - Intronic
1170763862 20:19274040-19274062 CTTTAACCCAGAGGGGAAGAGGG - Intronic
1171133788 20:22678490-22678512 CTCCGGGCCTGATGGGAGGAAGG + Intergenic
1171540877 20:25954607-25954629 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1171800191 20:29605703-29605725 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1171843904 20:30251000-30251022 CTCTAGGCCTGAAGGGATGAAGG - Intergenic
1172125620 20:32623650-32623672 CTCTGTGGCGGTGGGGAAGAGGG + Intergenic
1172697284 20:36831484-36831506 CTCCTTGCCAGAAGGGAAGAGGG + Intronic
1173476549 20:43363909-43363931 CTCCGGGTGAGATGGGAAGAAGG - Intergenic
1173595385 20:44255777-44255799 CCCTGGACCAGAGTGGAAGGTGG + Intronic
1173686119 20:44924430-44924452 GTCTGGGCTGGAGGGGAAGAGGG + Intronic
1173799591 20:45886765-45886787 CTCTGAGGCAGTGGGGAAGGAGG - Exonic
1174231161 20:49046531-49046553 CTCTGGGCGAGAGCGGAATGTGG + Intronic
1174616949 20:51843042-51843064 AGCTGGGCCAGAGGGTAGGACGG - Intergenic
1175013776 20:55766209-55766231 CTCTAGGCCAGTGGGAAAGATGG - Intergenic
1175013836 20:55766969-55766991 CTCTGGGGCAGAGGAGCAGAGGG - Intergenic
1175320005 20:58078803-58078825 CTCTGGGGCACAGGGGCAGGGGG - Intergenic
1176132780 20:63503262-63503284 CTCTGGGCCCTGGAGGAAGAGGG + Intergenic
1176145167 20:63562246-63562268 CTGGGGGCCAGAGGGGAAGCTGG + Intronic
1176767651 21:13037069-13037091 CCTGGGCCCAGAGGGGAAGAGGG - Intergenic
1177113258 21:17054685-17054707 GTCTGGGCGACAGAGGAAGACGG - Intergenic
1177401701 21:20613841-20613863 CACAGGCCCAGAGGGGTAGAAGG + Intergenic
1177706184 21:24707956-24707978 CTCTGGGCCAGAGGGGAACCTGG - Intergenic
1179011726 21:37561687-37561709 CCCTGGGGCTGAGGGCAAGAGGG + Intergenic
1179180873 21:39043886-39043908 CTCTAGGCCTGAGGGGAAGGGGG - Intergenic
1179225610 21:39450487-39450509 CTCTGGGACTCAGGTGAAGAGGG + Intronic
1180043229 21:45291244-45291266 CTTTGGGACAGACGGCAAGATGG + Intergenic
1180157895 21:45986858-45986880 CACAGGGCCAGAGGGGAGGCTGG - Intronic
1180699307 22:17773132-17773154 CCCTGGGCAAGAGGGGCAGAAGG + Intronic
1181897177 22:26120528-26120550 CTATGGGCAAGGGGGAAAGAAGG + Intergenic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1182851578 22:33479106-33479128 CTCTTGGCCACAGAGGAAGTTGG - Intronic
1183083684 22:35473581-35473603 CTCTGAGACAGTGGGGAGGAAGG - Intergenic
1183303750 22:37071031-37071053 CCCTGGGACAGAGGGGATGGGGG + Exonic
1183677293 22:39306740-39306762 CCCTGGGCCATGGGGGAAGATGG + Intergenic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184396190 22:44243085-44243107 CTCTGGGCCCCAGGTGAAGTGGG + Intergenic
1184441805 22:44521539-44521561 CTCTGGGCCACATGGGAGGTGGG - Intergenic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
1185329500 22:50245826-50245848 TTCTGGACCAGGGGCGAAGACGG + Exonic
949477181 3:4459028-4459050 GGCTGGGGGAGAGGGGAAGATGG + Intronic
950075953 3:10187393-10187415 CTCTGGGTCAGACAGGAAGGCGG + Intronic
950652494 3:14415994-14416016 CCCTTGGTCAGAGGGGAACAAGG - Intronic
950684152 3:14604483-14604505 CTCTGGCTCAGAGAGGAAGAGGG + Intergenic
953196618 3:40740110-40740132 CACTTGGACAGTGGGGAAGAAGG + Intergenic
953446116 3:42968897-42968919 GTGTGGGCAAGAGGGTAAGAGGG + Intronic
954400652 3:50317914-50317936 CTCCCTGCCAGAGGGGAAGGAGG - Exonic
954591988 3:51790781-51790803 TTCTGGGCCAAAGGGTATGAAGG + Intergenic
954610917 3:51944068-51944090 ACCTGGGCCAGAGGGGAGGTGGG - Exonic
955322226 3:57982592-57982614 CTCAGGGCCTGAGAGGAAAATGG - Intergenic
957079528 3:75624037-75624059 CTAAGAGCCAGGGGGGAAGAGGG + Intergenic
957182647 3:76900288-76900310 CTCTGTGACAGAGGGTAATATGG - Intronic
957660972 3:83152838-83152860 TTCTGGCCCAGAGGAGGAGATGG - Intergenic
958698681 3:97559617-97559639 CTCAGGGCAAAAGGGGAAGCAGG + Intronic
959008878 3:101050956-101050978 ATCTGGGGCAGAAGGTAAGAGGG + Intergenic
959017995 3:101157924-101157946 CTCTGGCCCAGAGTGAAAGACGG + Intergenic
960220869 3:115106798-115106820 CTGGGGGGCAGAGGGGAAGAAGG - Intronic
961044941 3:123701588-123701610 CTGCTGGCCAGCGGGGAAGATGG + Intronic
961782271 3:129327235-129327257 CTCTGGGCCGTAGGGGATGATGG - Intergenic
962234927 3:133699637-133699659 CACTAAGCCAGAGGGGAAGATGG - Intergenic
962362984 3:134756984-134757006 CTCTGAGCCAGATGGAAATAGGG + Intronic
962860350 3:139394084-139394106 GCCTGGGCCAGAGAGTAAGAAGG + Intergenic
963604774 3:147404988-147405010 CTCTGAGCCAGAGAGGAAACTGG + Intronic
963778717 3:149465488-149465510 CTCTGGGCCAGAAATGGAGATGG - Intergenic
963831521 3:150014266-150014288 CTGTGGGCCAGATGGGAGAAGGG + Intronic
964546127 3:157835563-157835585 CTTTGGGCAAGAGGGGAACTAGG - Intergenic
964646277 3:158961344-158961366 CTCTGTGCCAGGGGGGAACAGGG + Intergenic
966781947 3:183591595-183591617 CTCTGCTCCAGAGGGGCTGACGG + Intergenic
966954062 3:184855012-184855034 CTCTGGGCCCTAGGGGAAGCAGG + Intronic
968053534 3:195673309-195673331 CTCAGGGGCAGAGGGGAAACTGG + Intergenic
968102279 3:195975053-195975075 CTCAGGGGCAGAGGGGAAACTGG - Intergenic
968542496 4:1175203-1175225 CTCTGGGTCTGAGGAGAGGAAGG + Intronic
968690438 4:1987281-1987303 CTGGGGGCCAGAGGGCAGGACGG - Intronic
969237298 4:5874600-5874622 TGCTGGGCAGGAGGGGAAGAGGG + Intronic
969347807 4:6580275-6580297 CTCTGGGCCTGTGGGGATGCAGG - Intronic
969909722 4:10432554-10432576 TTATGGTCCAGTGGGGAAGACGG - Intergenic
970142557 4:12998115-12998137 ATCTAAGACAGAGGGGAAGATGG - Intergenic
970416443 4:15862349-15862371 CTGAGGGCAAGAGGGAAAGATGG - Intergenic
971889482 4:32499538-32499560 CTCTAGGCAATAGGAGAAGAAGG - Intergenic
972365610 4:38371603-38371625 CTTTGGGCCAGTGGGGGAGAGGG - Intergenic
972463680 4:39330966-39330988 CTCTTTGCCAGACGGGAAAAAGG + Intronic
974108932 4:57503767-57503789 CTCAGGGACTGAGGGGAGGAGGG - Intergenic
975319816 4:72997094-72997116 TTCTGGGGCAAAGGGGAAAATGG + Intergenic
975365551 4:73523994-73524016 CCCTGGGCCAGAGGGGAGCCTGG - Intergenic
976390306 4:84498931-84498953 CCGTGGGCCAGAGGGCAAGGCGG - Intergenic
980092302 4:128455490-128455512 CTATGGGACAGAGGGTATGAGGG - Intergenic
981936990 4:150249333-150249355 CTCTAGTCCTGAGGGGCAGAGGG + Intronic
985499828 5:235924-235946 CTCAGGGGCAGAGGGGAAACTGG + Intronic
985737561 5:1593768-1593790 CTCAGGGGCAGAGGGGAAACTGG - Intergenic
986240120 5:5953381-5953403 CTCTTGGCCATTTGGGAAGAAGG - Intergenic
986726228 5:10599492-10599514 ATCAGGGGCTGAGGGGAAGAGGG - Intronic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987588657 5:19893122-19893144 CTCAGAGGCAGAGGGGCAGAGGG - Intronic
987880658 5:23740446-23740468 CTCTGGCCCAGAGGTGATGCTGG - Intergenic
988436056 5:31176937-31176959 CTTTGGCCCAGAGGGGAATTGGG + Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
990372577 5:55135832-55135854 CCCTGGGCCACATTGGAAGAAGG - Intronic
990948093 5:61270636-61270658 CCCTGGGCCAAAGGGCCAGAGGG - Intergenic
991499495 5:67262956-67262978 CTCTGGGGCTGAAGGTAAGAAGG + Intergenic
991964412 5:72076986-72077008 CCCTGGGCCAGAAGGGGAGAAGG - Intergenic
992485550 5:77191034-77191056 CTGTGTGCCAGCTGGGAAGAAGG - Intergenic
993991303 5:94661197-94661219 CTCTGGGCCAGTGAGGACTAAGG + Intronic
994139147 5:96322643-96322665 TTCTGGCCCAGAGGAGAACAAGG + Intergenic
994941577 5:106330268-106330290 CTGTGGAGCAGAGGGGAAGGAGG - Intergenic
995573736 5:113508302-113508324 TTATGGGCCAGAGGAGAGGAAGG + Intergenic
997198707 5:131996765-131996787 CTCTGAGCTAGATGAGAAGAGGG - Intronic
997720989 5:136078308-136078330 CCCTGGGCCACATTGGAAGAAGG + Intergenic
998215710 5:140237401-140237423 CACTGGGCCAGAAGGCAGGAGGG + Intronic
998628910 5:143876792-143876814 TTCTGGGGCAGAGTGGAAGGAGG + Intergenic
999395234 5:151223087-151223109 CTGTGAGGCAGAGGGGAAGAAGG - Intronic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1000355936 5:160395894-160395916 CTTTGGGGCTGAGTGGAAGAAGG - Intronic
1001077311 5:168639564-168639586 CTCTTGGGCAGTGTGGAAGATGG - Intergenic
1001142173 5:169153682-169153704 CTCTTGGGCAGAGGGGATGTTGG + Intronic
1001170595 5:169415723-169415745 TTCTGGGGTAGAGAGGAAGAAGG - Intergenic
1001318677 5:170662773-170662795 CTCTGGGCCAGAGGGAAAGGAGG - Intronic
1001711785 5:173784643-173784665 CTCTGGGACAGTGGGGAAGATGG - Intergenic
1002563904 5:180099624-180099646 CTCTGGGGCAGCAGGGAAGGAGG - Intergenic
1002570409 5:180136628-180136650 CTCTGTGCCAGGGAGGAGGAGGG + Intronic
1002618031 5:180467581-180467603 TTCTGGACCAGTGGGGAAGAGGG - Intergenic
1002820618 6:721107-721129 CCCTGGGCCACACTGGAAGAAGG - Intergenic
1003073434 6:2962217-2962239 ATCTGGGGCAGAGGAGAAGTCGG + Intronic
1003134950 6:3427898-3427920 CTCTGGTCGGGAGAGGAAGAAGG + Intronic
1003507348 6:6750977-6750999 CTCAGGGGGAGAGGGGAAGCTGG - Intergenic
1003981995 6:11398480-11398502 CTCTGTGCAGGAGGTGAAGAAGG + Intergenic
1004627395 6:17389880-17389902 CCCTGGGCCACAGTGGAAGAAGG - Intergenic
1005411118 6:25547978-25548000 TTCTGGCCCAGAGGGGAAAATGG + Intronic
1005823642 6:29618664-29618686 CTGTGGGCTAGAGGGGAATGTGG - Intronic
1006168064 6:32077169-32077191 CCCTGGGACAGAGCGGCAGAGGG + Intronic
1006184477 6:32173169-32173191 CACTGGGGCAGAGTGGAGGAAGG - Intronic
1006381005 6:33697151-33697173 CTCTGAGTCAGTGGGGATGAGGG + Exonic
1006638837 6:35478456-35478478 GCCTGGGGCAGAGGGGAAGGTGG + Exonic
1006826151 6:36937773-36937795 CTTTGGGCCAGAAAGGAAGATGG + Intergenic
1006894033 6:37454836-37454858 CTCTGGTCCTCAGGGGAAAACGG - Intronic
1007843458 6:44735439-44735461 CACTGGCCCAGATGGGAAAAGGG - Intergenic
1008911187 6:56735526-56735548 TTATGGGACAGAGGGGCAGAGGG - Intronic
1011914591 6:92488140-92488162 CTCTGGGCCAGATGGGAGCCCGG - Intergenic
1012049908 6:94328444-94328466 CCCTGGGCCAGAAGGGAACCTGG + Intergenic
1012527229 6:100192591-100192613 CTCTGGACCAGAGGAAAACATGG + Intergenic
1013010799 6:106118113-106118135 CCCTGGGCCACAAGGGAAGGAGG + Intergenic
1015625615 6:135178696-135178718 CCCTGGGCCACATTGGAAGAAGG - Intergenic
1017594594 6:156014877-156014899 CACTCGGCCAGAGGGGCAGTGGG + Intergenic
1017954532 6:159167880-159167902 CCCTGAGCCAGTGGGGAAGTGGG + Intergenic
1018219024 6:161560324-161560346 TTCAAGGCCAGAGGTGAAGATGG + Intronic
1018735494 6:166684652-166684674 CTCTGGGGCAGAGCAGAGGAGGG - Intronic
1019282504 7:207559-207581 CTCCGGTGCAAAGGGGAAGAGGG - Intronic
1019436540 7:1025156-1025178 CTCTGGGCCAGGGTGGAGGCCGG + Intronic
1019937765 7:4267483-4267505 CTCCGGGGCCGAGGGGAAGGAGG - Exonic
1019973872 7:4564143-4564165 CTCTGGCCCAGTGGGGATGAAGG - Intergenic
1020129594 7:5552243-5552265 GTCTGGGCCAGAGGGGACAGGGG - Intronic
1021471000 7:21002517-21002539 CTCTGGGACAAAGGAGGAGAAGG + Intergenic
1021608314 7:22431874-22431896 CTCTGGGCCAGATGGGATAAGGG - Intronic
1022045667 7:26620466-26620488 GACTGGGCCAGAGGGAGAGAGGG - Intergenic
1022530782 7:31065692-31065714 CTCTTGGCCTCAGGGGAAGTTGG + Intronic
1022538663 7:31114899-31114921 ATCAGGGGCAGAGGGGAGGAGGG - Intergenic
1023052648 7:36266730-36266752 GGCTGGGCAAGAGGGGAAGGGGG - Intronic
1023310634 7:38882799-38882821 CTCTGGGCTAGAGGCGATGAAGG - Intronic
1023652705 7:42388405-42388427 CTTTGTGCCAGAGGGGACCAGGG - Intergenic
1023931581 7:44709465-44709487 CTCTTGGCCAGAGGGGACCCAGG - Intergenic
1024120291 7:46229961-46229983 CACTGAGCCAGAGGTGAAAATGG - Intergenic
1024410529 7:49036185-49036207 CTTTGGGCCCTAGTGGAAGATGG + Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1026246330 7:68623220-68623242 GTCTGTGACAGAGGGGGAGAAGG - Intergenic
1026344818 7:69465020-69465042 TTCTGTGACAGAGGGGATGAGGG + Intergenic
1026885284 7:73938242-73938264 CTGTGGGCCAGAGGGAAAGCAGG - Intergenic
1026896142 7:74011062-74011084 CTGAGGGCCAGAGGGGCAGTGGG - Intergenic
1027989357 7:85336776-85336798 CTCTTGGCAAGAGTGGATGAGGG + Intergenic
1029195802 7:98804492-98804514 GTCTGTGGCAGAGGGGAGGAGGG - Intergenic
1029539910 7:101176585-101176607 CTATGGGGAAGAGGGGCAGAAGG - Intronic
1029597043 7:101543461-101543483 CTCTGGGCCAGAGGGAGAAAAGG + Intronic
1030153158 7:106426341-106426363 CTTTGAGCTAGAAGGGAAGAGGG - Intergenic
1032057447 7:128695216-128695238 CTCTGGGGCAGAGAGCAGGATGG - Intergenic
1032087698 7:128892478-128892500 CACTGGGCCTGAGGGGATCAGGG - Intronic
1032139078 7:129310016-129310038 CTCTGGGACAGAAAGGAAAAAGG - Intronic
1032333210 7:130999553-130999575 CCCTCCACCAGAGGGGAAGAGGG - Intergenic
1032498637 7:132382190-132382212 CTCTGGGCTTCAGGGAAAGAAGG - Intronic
1034447758 7:151122191-151122213 CCCTGGGCCAAAGGGGCAGAGGG + Intronic
1034478167 7:151300688-151300710 TTCTGGGCCACAAGGGAACAAGG + Intergenic
1034801476 7:154058748-154058770 CTCAGAGCCGGGGGGGAAGAGGG - Intronic
1034802430 7:154062286-154062308 CTCAGAGCCGGGGGGGAAGAGGG - Intronic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1034947038 7:155268968-155268990 ACCTCGGCCAGAGGGGAAAAGGG + Intergenic
1035236654 7:157501369-157501391 CTCGGGGCCTGAGGAGCAGAAGG + Intergenic
1036614753 8:10379578-10379600 CAGGGTGCCAGAGGGGAAGAGGG - Intronic
1036635863 8:10549115-10549137 CCCTGGTCTAGAGGGGGAGATGG + Intronic
1037081274 8:14789630-14789652 TCCTGGGTCAGAGAGGAAGATGG - Intronic
1037470280 8:19201860-19201882 CTCTCGGGAAGAGGGGAAAATGG + Intergenic
1037588044 8:20291396-20291418 CTTTGGAACTGAGGGGAAGAGGG + Intronic
1037674398 8:21041421-21041443 CTCAGGGCCAGCCAGGAAGAAGG + Intergenic
1037966121 8:23135210-23135232 CTGTGGGCCAGAGGGAGAGCAGG + Intergenic
1040067729 8:43161855-43161877 CTCAGGGCCAGAGAGGGGGAAGG - Intronic
1041383699 8:57278379-57278401 CTGGGGCCCAGAGGGGAAGCGGG - Intergenic
1041741478 8:61162077-61162099 CTCTGGGAAAGACGGCAAGAAGG - Intronic
1043486140 8:80701102-80701124 TTCTGGGCCAGTGGAGCAGAAGG - Intronic
1046611827 8:116434079-116434101 TTCTTGGAGAGAGGGGAAGAGGG - Intergenic
1047249114 8:123168367-123168389 CCCTGGGCCACACTGGAAGAAGG - Intergenic
1048956761 8:139543769-139543791 CCCTGGGCCAGGTGGGAAGGAGG + Intergenic
1049337869 8:142096102-142096124 TCCTGGGGCAGTGGGGAAGAGGG + Intergenic
1049594561 8:143477430-143477452 GTCTGGGCCAGAGGGGTGGAGGG + Intronic
1049642761 8:143722786-143722808 CTCTGAGCCAGAGGAGAGAAGGG + Intergenic
1049675622 8:143887626-143887648 TCCTGGGCCAGAGGGGAAGCAGG - Intergenic
1049894892 9:104093-104115 CTAAGAGCCAGGGGGGAAGAGGG - Intergenic
1050594711 9:7194087-7194109 CCCTGGGCCAAGGGGGAGGAGGG - Intergenic
1051678375 9:19581443-19581465 TTCTGGGCCTGAGGTGGAGAGGG - Intronic
1052398480 9:27971291-27971313 CTTTGGGTGAGAGGGAAAGATGG - Intronic
1052994973 9:34547126-34547148 TTCTAGGCCAGAAGGCAAGAAGG - Intergenic
1053707470 9:40769172-40769194 CCTGGGCCCAGAGGGGAAGAGGG + Intergenic
1054164194 9:61704849-61704871 CTCTAGGCCTGAAGGGATGAAGG + Intergenic
1054328377 9:63729332-63729354 CTGTGGGCTAGAGGGGCAGCTGG - Intergenic
1054417382 9:64889940-64889962 CCTGGGCCCAGAGGGGAAGAGGG + Intergenic
1055963673 9:81844517-81844539 CTCTGGGCCAGAGGGCAGAGAGG - Intergenic
1056628841 9:88276050-88276072 ATGTGGGGCAGAGGGGAAGAGGG - Intergenic
1056918252 9:90763052-90763074 CTAAGAGCCAGAGGGGGAGAGGG + Intergenic
1057218853 9:93244858-93244880 CTCTGAGCCAGAAGGGAACCTGG + Intronic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057371786 9:94480170-94480192 CGTTGGGCCAGAGGAGAAGCTGG + Intergenic
1057421885 9:94919431-94919453 CTCAGGGCCAGAGGGAAGGAGGG + Intronic
1058395560 9:104549598-104549620 CTCCATGGCAGAGGGGAAGAAGG - Intergenic
1058767781 9:108198599-108198621 CCCTGGGCCAGAAGGGAACCCGG + Intergenic
1059440028 9:114301555-114301577 CTCTGGCACAGACGGGATGACGG - Intronic
1060432452 9:123561972-123561994 GTCTGGGCCAGAGAGGGTGATGG - Intronic
1061163833 9:128911233-128911255 CCCTGGGGAAGAGGGGAGGAAGG - Intronic
1061497122 9:130981516-130981538 CTGTGGCCCTGAGGGGAAGTGGG - Intergenic
1061501291 9:131004123-131004145 CTCTGGCCAAGAGGGGAGGTGGG + Intergenic
1061509376 9:131051064-131051086 CTCTGGGGCAGAGGGACACAGGG + Intronic
1061610179 9:131740474-131740496 CTCTGGCCCACAGGGGATGCTGG - Intergenic
1061797970 9:133099239-133099261 CTGTGGGCCAGAGGAGATGGTGG - Intronic
1061802796 9:133121280-133121302 GGCGGGGCCGGAGGGGAAGAGGG + Intronic
1061990778 9:134157466-134157488 CTCAGGGTCCGAGGAGAAGAGGG + Intronic
1062259309 9:135652094-135652116 CTCAGGCCAAGATGGGAAGAGGG - Intergenic
1062694895 9:137868786-137868808 CTCTGGGCAGGTGGGGAAGGGGG + Intronic
1186352272 X:8751915-8751937 CTCTTGGCCAGAGAGCAAGCAGG - Intergenic
1187039671 X:15580307-15580329 CTCTGAGGCAGAGGGGAATGAGG - Intronic
1187173209 X:16870775-16870797 CTCAGAGCAAGAGGGGAAAATGG + Intergenic
1188010792 X:25053724-25053746 TCCTGAGTCAGAGGGGAAGATGG + Intergenic
1190574472 X:51819175-51819197 ATGTGGGGCAGAGGGGAAGAAGG - Intronic
1191707156 X:64105352-64105374 CTCTGGCTCAGCTGGGAAGACGG - Intergenic
1191953519 X:66619729-66619751 CTCTGGGCAAGTTGGGAAGTTGG - Intronic
1194067338 X:89277477-89277499 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1198708179 X:139472209-139472231 CTTGGGGCCAGAGATGAAGAAGG - Intergenic
1200150921 X:153951081-153951103 CTATGGGCCAGAGGGAAAAGAGG + Intronic
1200721496 Y:6611691-6611713 CTCTGTGTAAAAGGGGAAGATGG - Intergenic