ID: 1122317728

View in Genome Browser
Species Human (GRCh38)
Location 14:100835747-100835769
Sequence TGCCCCCGACAAGCCCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122317716_1122317728 26 Left 1122317716 14:100835698-100835720 CCCCAGGAGCCACTCCCACTCCA 0: 1
1: 0
2: 1
3: 30
4: 385
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317717_1122317728 25 Left 1122317717 14:100835699-100835721 CCCAGGAGCCACTCCCACTCCAG 0: 1
1: 0
2: 4
3: 41
4: 350
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317724_1122317728 -1 Left 1122317724 14:100835725-100835747 CCTGTTTCCAGCAGGTTCCCAGT 0: 1
1: 0
2: 3
3: 17
4: 219
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317723_1122317728 6 Left 1122317723 14:100835718-100835740 CCAGCTGCCTGTTTCCAGCAGGT 0: 1
1: 0
2: 2
3: 16
4: 265
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317725_1122317728 -8 Left 1122317725 14:100835732-100835754 CCAGCAGGTTCCCAGTGCCCCCG 0: 1
1: 0
2: 1
3: 27
4: 236
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317721_1122317728 11 Left 1122317721 14:100835713-100835735 CCACTCCAGCTGCCTGTTTCCAG 0: 1
1: 0
2: 1
3: 53
4: 428
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317715_1122317728 30 Left 1122317715 14:100835694-100835716 CCTGCCCCAGGAGCCACTCCCAC 0: 1
1: 0
2: 2
3: 54
4: 491
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317720_1122317728 12 Left 1122317720 14:100835712-100835734 CCCACTCCAGCTGCCTGTTTCCA 0: 1
1: 1
2: 1
3: 39
4: 385
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317719_1122317728 17 Left 1122317719 14:100835707-100835729 CCACTCCCACTCCAGCTGCCTGT 0: 1
1: 0
2: 7
3: 109
4: 772
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142
1122317718_1122317728 24 Left 1122317718 14:100835700-100835722 CCAGGAGCCACTCCCACTCCAGC 0: 1
1: 0
2: 5
3: 61
4: 509
Right 1122317728 14:100835747-100835769 TGCCCCCGACAAGCCCCTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122317728 Original CRISPR TGCCCCCGACAAGCCCCTGC TGG Intergenic