ID: 1122318442

View in Genome Browser
Species Human (GRCh38)
Location 14:100839359-100839381
Sequence CTCCTTTGGAAGAGGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122318442_1122318453 25 Left 1122318442 14:100839359-100839381 CCCTGTCCCCTCTTCCAAAGGAG No data
Right 1122318453 14:100839407-100839429 CCATCCCCGATTTGAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122318442 Original CRISPR CTCCTTTGGAAGAGGGGACA GGG (reversed) Intergenic
No off target data available for this crispr