ID: 1122319562

View in Genome Browser
Species Human (GRCh38)
Location 14:100845606-100845628
Sequence CCGCCAGGCGGACCTCGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122319555_1122319562 -5 Left 1122319555 14:100845588-100845610 CCAGCTGCCCGGAGCACACCGCC 0: 1
1: 0
2: 0
3: 21
4: 216
Right 1122319562 14:100845606-100845628 CCGCCAGGCGGACCTCGTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 70
1122319553_1122319562 15 Left 1122319553 14:100845568-100845590 CCTTGCTGCTGAGGGTGGGGCCA 0: 1
1: 0
2: 6
3: 52
4: 349
Right 1122319562 14:100845606-100845628 CCGCCAGGCGGACCTCGTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122319562 Original CRISPR CCGCCAGGCGGACCTCGTGG AGG Intergenic
903000026 1:20258629-20258651 CCGCCCTGCGGCCCTCCTGGTGG - Intergenic
910835208 1:91501359-91501381 CAGCCAGCGGGACCGCGTGGGGG - Intronic
923605337 1:235438174-235438196 CCTCCAGGCAGACCTGGGGGAGG + Intronic
1066079429 10:31915309-31915331 CCGGGAGGCGGAGGTCGTGGTGG + Intronic
1067225385 10:44372920-44372942 CCCCCAGGCGTCCCTCTTGGTGG + Intronic
1067711888 10:48656430-48656452 CCCCCTGGCGGGCCTCGGGGAGG + Intergenic
1069818286 10:71212456-71212478 CCGACAGGGGGACCTTGAGGGGG - Intergenic
1071567505 10:86679402-86679424 CAGCCAGGGTGACCTCGTGGTGG + Exonic
1074546128 10:114403801-114403823 CCGGCAGGTGGAGCTCCTGGAGG - Intronic
1076494066 10:130885400-130885422 CCGCCAGGCGGATCCAGTGCTGG + Intergenic
1079217489 11:18526810-18526832 TCGCCAGGCGGCCGTCATGGCGG - Exonic
1095942888 12:47738037-47738059 CCACCTGGCTGTCCTCGTGGAGG + Exonic
1116826360 14:49677072-49677094 CAGCCATGTGGACCTAGTGGAGG + Intronic
1121023113 14:90593848-90593870 CCGCTAGGCTGAGCTCCTGGAGG - Intronic
1122319562 14:100845606-100845628 CCGCCAGGCGGACCTCGTGGAGG + Intergenic
1122951488 14:105047497-105047519 GCCCCAGGAGCACCTCGTGGAGG + Intergenic
1129414599 15:75368293-75368315 CGGCCAGGCAGCCCTCTTGGCGG - Intronic
1136913961 16:34163763-34163785 CTGCCAGACGGGCCGCGTGGCGG - Intergenic
1137280715 16:46974007-46974029 GCGCCAGGCGGGCCTCCTGCGGG - Intergenic
1139357779 16:66377500-66377522 GCGCCAGGCTGACCTCAGGGAGG - Intronic
1141925960 16:87169746-87169768 CCGCCATGAGGAGCTGGTGGGGG - Intronic
1144608837 17:16690616-16690638 CTTCCAGGCGGACGTCGTGCTGG - Exonic
1144903987 17:18625210-18625232 CTTCCAGGCGGACGTCGTGCTGG + Intergenic
1145128598 17:20321532-20321554 CTTCCAGGCGGACATCGTGCTGG - Intergenic
1145196024 17:20895783-20895805 CTTCCAGGCGGACATCGTGCTGG + Exonic
1150228120 17:63534697-63534719 CAGCCAGGTGGACATAGTGGAGG - Intronic
1152524611 17:80880417-80880439 GTGCCAAGCGGACCTCGTGAAGG + Exonic
1152754501 17:82081619-82081641 CAGCCAGCGGGACCTGGTGGAGG - Exonic
1152918180 17:83052498-83052520 CCTCCTGGGGGACCTCGCGGTGG - Intergenic
1152918201 17:83052549-83052571 CCTCCTGGAGGACCTCCTGGTGG - Intergenic
1152918238 17:83052651-83052673 CCTCCTGGGGGACCTCCTGGTGG - Intergenic
1152918259 17:83052702-83052724 CCTCCTGGGGGACCTCGCGGTGG - Intergenic
1152918280 17:83052753-83052775 CCTCCTGGGGGACCTCCTGGTGG - Intergenic
1152918301 17:83052804-83052826 CCTCCTGGGGGACCTCGCGGTGG - Intergenic
1152918321 17:83052855-83052877 CCTCCTGGGGGACCTCCTGGTGG - Intergenic
1152918342 17:83052906-83052928 CCTCCTGGGGGACCTCGCGGTGG - Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1163105789 19:15122484-15122506 AAGCAAGGCGGCCCTCGTGGAGG - Intronic
1166092535 19:40519605-40519627 GCGCCAGGCGGCCCTTCTGGAGG + Exonic
1166365206 19:42274602-42274624 GCGCCAGGCTCACCTCGTAGAGG + Intronic
926310270 2:11669901-11669923 GCGCCAGGCTGAGCACGTGGTGG + Exonic
926980189 2:18560290-18560312 CGGCCTGGCGGAGCTCGCGGCGG + Exonic
928407838 2:31028482-31028504 CCGCTAACCGGACCTGGTGGAGG - Intronic
943365355 2:186962645-186962667 CCCCCAGGCGGCCCTAGCGGGGG + Intergenic
944273192 2:197805279-197805301 CAGCGAGGCGGGCCTCCTGGAGG + Exonic
948560081 2:238846760-238846782 CGGCCAGGCGGGCCGCGAGGTGG - Intergenic
1171406911 20:24917879-24917901 CCACCAGGCAGGCCACGTGGAGG + Intergenic
1171810114 20:29740838-29740860 CTGCCAGACGGGCCGCGTGGCGG + Intergenic
1172091227 20:32434508-32434530 CCGGCAGGAGGACTCCGTGGTGG - Exonic
1175621268 20:60449468-60449490 CAGCCAGGCTGACCTTCTGGTGG + Intergenic
1175893873 20:62327516-62327538 CCTGCAGGCGCACCTCCTGGCGG + Exonic
1176178199 20:63738370-63738392 CCGCCAGGCTGACCCCGGGAAGG - Exonic
1177757165 21:25361859-25361881 CCGCCAGGCGGACCAGGAGATGG - Intergenic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
954441946 3:50526813-50526835 CCCCCAGGCTGCCCTCTTGGAGG + Intergenic
960127310 3:114014542-114014564 CCGCCAGGCTCACCTGGAGGTGG - Intronic
968514401 4:1010233-1010255 CCGCCGGGAGGACCACGCGGCGG + Intronic
970333173 4:15004326-15004348 CCGCCCGCCGTACCTGGTGGTGG - Exonic
980416564 4:132496326-132496348 GCGCCAGGTGGACATCTTGGAGG + Intergenic
983999021 4:174218019-174218041 CCGCCAGGCAGACCTCCTGCGGG + Intergenic
985960899 5:3302589-3302611 CCCCCAGGGGGACCTGGAGGAGG - Intergenic
1002717027 5:181234229-181234251 CTGCCAGGCGGACCCCCCGGCGG - Exonic
1007465893 6:42050684-42050706 CCGCCAGTCGGAGCTCATGATGG - Intronic
1010794751 6:80106421-80106443 CCGCACGGCCGACCTCGGGGAGG + Intergenic
1035570638 8:670464-670486 CCGCCAGGCAGACCGAGTAGAGG + Intronic
1037473941 8:19237834-19237856 CCGGCTGGTGAACCTCGTGGTGG + Intergenic
1047064423 8:121264431-121264453 CAGCCAGGGGAACTTCGTGGAGG + Intergenic
1047381916 8:124372248-124372270 CTGGCAGGAGGACCTCGGGGCGG - Exonic
1049664212 8:143835807-143835829 CCGCCCAGCGCACCTCGTGGAGG + Exonic
1055611789 9:78031619-78031641 CCGCCAGGCGCACGGCGTAGGGG - Intergenic
1056942153 9:90964952-90964974 CTGCCAGGAGGACCCCTTGGGGG - Intergenic
1062452156 9:136620319-136620341 CCGCCAGGCTGACCTGGGGTTGG + Intergenic
1203360402 Un_KI270442v1:216577-216599 CTGCCAGACGGGCCGCGTGGCGG + Intergenic
1185792508 X:2938117-2938139 CCGCCAGCCGGACCACGGTGGGG + Exonic
1186760386 X:12716724-12716746 CTGCGAGGAGGACCTCGTGGTGG + Exonic