ID: 1122319725

View in Genome Browser
Species Human (GRCh38)
Location 14:100846677-100846699
Sequence GTGTACACACACTCTCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122319725_1122319729 9 Left 1122319725 14:100846677-100846699 CCAGGATGAGAGTGTGTGTACAC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1122319729 14:100846709-100846731 GTTCATCCGCTTTGATGGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 74
1122319725_1122319728 4 Left 1122319725 14:100846677-100846699 CCAGGATGAGAGTGTGTGTACAC 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1122319728 14:100846704-100846726 CCATGGTTCATCCGCTTTGATGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122319725 Original CRISPR GTGTACACACACTCTCATCC TGG (reversed) Intergenic
901662231 1:10805767-10805789 GTGGACACACACATTCATACGGG - Intergenic
901846517 1:11986406-11986428 GTGCACACACCCCCTCATCCAGG + Intronic
901880135 1:12188931-12188953 CTGTACACACACGCTCCTCCAGG - Intronic
905677742 1:39840502-39840524 GTGTACACAAACACCAATCCAGG - Intergenic
911374338 1:97032686-97032708 GGGTACCCACACAGTCATCCAGG - Intergenic
911774413 1:101789845-101789867 GTGTATACATACTCTTATCTGGG + Intergenic
912171153 1:107101065-107101087 ATGTACCCACACTCCCATCCTGG - Intergenic
913490014 1:119370292-119370314 ATTGACACACACTCTCAGCCAGG - Intronic
918139035 1:181704617-181704639 ATGGAAACACACACTCATCCTGG - Intronic
920641306 1:207753972-207753994 GTTTACACACACATTCATGCAGG + Intronic
921938335 1:220815201-220815223 GTGTACACTCACTCTCCCACGGG - Exonic
1063374990 10:5548963-5548985 GTGCACACACACACGCCTCCTGG + Intergenic
1064072346 10:12241595-12241617 GCGTTTACAGACTCTCATCCGGG + Intronic
1064399563 10:15010423-15010445 GTGTACACCCACTGTGATACTGG - Intergenic
1067478787 10:46582434-46582456 GTTTTCACCCACTCTCTTCCAGG - Intronic
1067615952 10:47759367-47759389 GTTTTCACCCACTCTCTTCCAGG + Intergenic
1074785803 10:116838371-116838393 GTCCACACACACTCTCACTCTGG - Intergenic
1075091790 10:119447939-119447961 GTGCTCACACACTCACAGCCTGG - Intronic
1075785146 10:125044217-125044239 GTGCACCCACAGGCTCATCCAGG + Intronic
1075815428 10:125261252-125261274 GTTCACACACACCCTCCTCCCGG - Intergenic
1077219430 11:1409075-1409097 GTGTACACACACCCTTACACAGG - Intronic
1078053167 11:7984960-7984982 GGATATACACACTCTCATCCTGG + Intronic
1083243240 11:61405296-61405318 GTGTACACACATACTCATAAAGG - Intronic
1084812094 11:71618457-71618479 GTGTACACCCACTGTGATACTGG + Intergenic
1084844811 11:71890527-71890549 GTGTACACACACTTTGATATTGG + Intronic
1084846605 11:71905576-71905598 GTGTACACTCACTCTGATATTGG + Intronic
1086444691 11:86860347-86860369 GTGTACACACCCTTTGATACTGG - Intronic
1091287275 11:134414649-134414671 GTGTACACACACCATCCCCCGGG + Intergenic
1092006676 12:5076103-5076125 GTTTACACCCACTCACATCCTGG - Intergenic
1092342630 12:7689693-7689715 GTGTGCACACACACACATCCTGG - Intergenic
1096228430 12:49883902-49883924 TCTTAAACACACTCTCATCCAGG - Intronic
1096524617 12:52203119-52203141 GTGTTCACACAGTCACATACAGG - Intergenic
1096736587 12:53660297-53660319 GTGCACACACACACACATACAGG + Intronic
1097175453 12:57139942-57139964 GTGTAAGCAGACTCCCATCCAGG + Intronic
1099848469 12:88059800-88059822 CTTTACAGACACTCTCATCAAGG + Intronic
1107040327 13:35941100-35941122 GAGAAGACACAGTCTCATCCAGG - Intronic
1107546941 13:41442390-41442412 GTGTACACCCACTGTGATACTGG - Intergenic
1112640737 13:101272159-101272181 GTACACACACACACTCATACAGG - Intronic
1113566611 13:111323171-111323193 ATGTCCACACTCACTCATCCGGG + Intronic
1114369600 14:22071235-22071257 CTGTACACAAACCCTCATCCGGG + Intergenic
1115517063 14:34196045-34196067 TTGTACACTCACTGTCTTCCTGG + Intronic
1117039380 14:51755403-51755425 GTGTACACCCACTGTGATACTGG + Intergenic
1120713932 14:87820326-87820348 GTGTATACACACACACATCTTGG - Intergenic
1120881685 14:89418735-89418757 GGGTACACATTGTCTCATCCTGG - Intronic
1122319725 14:100846677-100846699 GTGTACACACACTCTCATCCTGG - Intergenic
1123543346 15:21317473-21317495 GTGCACACACACACACCTCCAGG + Intergenic
1127668973 15:61176213-61176235 GTGTTCAAACACTCTCTTCTTGG + Intronic
1127802066 15:62485469-62485491 ATGTCCACAGCCTCTCATCCAGG - Intronic
1130188889 15:81712637-81712659 GTGTACACGCACTCCGATACTGG - Intergenic
1133187673 16:4111581-4111603 GTGTAGACATACTCTATTCCTGG + Intronic
1135158685 16:20074610-20074632 GTGTACTCACACGCTCACTCAGG + Intergenic
1137862490 16:51860616-51860638 TTCTATCCACACTCTCATCCAGG + Intergenic
1139150903 16:64381139-64381161 GAGTGCACACACTCCCAGCCAGG - Intergenic
1141040639 16:80669847-80669869 GTGTGCACTCACTCTCCTCATGG - Intronic
1141568062 16:84916678-84916700 GTGTCCACACTCGCTCCTCCAGG - Intronic
1203141811 16_KI270728v1_random:1771787-1771809 GTGTCCACACTCTCTCCTCTGGG - Intergenic
1143395320 17:6589978-6590000 CTGTTCCCACACTTTCATCCAGG + Exonic
1144574545 17:16420710-16420732 GTAAACACAGTCTCTCATCCTGG + Intronic
1146798613 17:35800699-35800721 GTGTACACATATGCTCATACGGG + Intronic
1147616238 17:41829926-41829948 GGGTACAAACACTCCCACCCCGG + Intronic
1148812047 17:50299450-50299472 ATGTACACACACACACACCCTGG - Intergenic
1151439044 17:74116319-74116341 GTGCAGACACACCCTCATGCTGG + Intergenic
1156835448 18:41547982-41548004 GGGTACACACCCTCTTCTCCAGG - Intergenic
1159206802 18:65264216-65264238 TTGCACACACACACTCACCCTGG + Intergenic
1161490649 19:4559430-4559452 GTGGAGACACTCTCCCATCCAGG + Intronic
1164244465 19:23418243-23418265 GTGTATACACTCTGTCACCCAGG - Intergenic
1165274111 19:34733499-34733521 GAGGACACAGACCCTCATCCTGG - Intergenic
1167082153 19:47283822-47283844 ATGCACAGACACACTCATCCAGG - Intergenic
1168165441 19:54543933-54543955 CTCTACCCACACACTCATCCTGG + Intronic
1168191494 19:54741545-54741567 GTGTCCACACACCCTGTTCCTGG - Intronic
1168193763 19:54758173-54758195 GTGTCCACACACCCTGTTCCTGG - Intronic
1168197715 19:54787763-54787785 GTGTCCACACACCCTGTTCCTGG - Intronic
1168204187 19:54837142-54837164 GTGTCCACACACCCTGTTCCTGG - Intronic
926409433 2:12587452-12587474 GTGCACATACACTCTACTCCCGG - Intergenic
927211548 2:20642064-20642086 GTATGCACACACCATCATCCTGG + Intronic
929735854 2:44548485-44548507 CTGTACACACACCCTCTCCCAGG + Intronic
931390441 2:61838369-61838391 GTGCACACACACTCACCTCATGG - Intronic
933610010 2:84423912-84423934 GTGTTCAAACACCCTCATCCTGG - Intronic
936453234 2:112649351-112649373 GTGCACACACACACTCTTGCAGG + Intronic
939422957 2:141997372-141997394 ATGTACACACACACACATCTTGG - Intronic
940869710 2:158849694-158849716 GTGTACACACACTTTGATACTGG + Intronic
946201728 2:218074420-218074442 GTGACCACACACTGTCATGCGGG - Intronic
946475838 2:220005641-220005663 GTGGATACACACACTCTTCCAGG + Intergenic
1170538095 20:17361824-17361846 GAGCACACACACTCTCATGCAGG - Intronic
1172669406 20:36624377-36624399 CTGTACTCACACTCACACCCTGG + Intronic
1173477025 20:43367092-43367114 GGGTACAGATCCTCTCATCCAGG - Intergenic
1175389949 20:58620732-58620754 GTGCACACACATTCACATGCAGG + Intergenic
1175536216 20:59716011-59716033 ATGGACACACACTCTCAAACTGG - Intronic
1176039650 20:63058662-63058684 GTGTGTACACACTCCCATGCAGG - Intergenic
1179516195 21:41908826-41908848 GTGTACACACACACACATACAGG + Intronic
1180958772 22:19753092-19753114 GTGTGCACACTCTCTCACACTGG + Intergenic
1182754924 22:32671603-32671625 GTGCACACACGCTCTCACACAGG + Intronic
1182754929 22:32671751-32671773 GTGCACACACACTGTCACACAGG + Intronic
1183109911 22:35641415-35641437 GTCTTCCCTCACTCTCATCCTGG - Intergenic
1184298883 22:43543396-43543418 GTGCACACACTCTCTCACCTCGG - Intronic
1184597512 22:45523192-45523214 CTGTACACACCCTCTCCTCTGGG - Intronic
949182249 3:1146447-1146469 ATGTACACACACTCTTTGCCTGG + Intronic
949885145 3:8686657-8686679 GTGTACACCCACTGTGATACTGG + Intronic
950730948 3:14956833-14956855 GTGTAAACACACACACAGCCGGG - Intronic
953693977 3:45143711-45143733 GTGCACACACACACTCTTCTGGG - Intronic
957043828 3:75359028-75359050 GTGTACACCCACTGTGATACTGG - Intergenic
957153153 3:76512665-76512687 ATGTACACACACTTTCTTTCAGG + Intronic
959981874 3:112526736-112526758 GTGTACACCCACTCTGATATTGG - Intergenic
962509902 3:136087748-136087770 ATGTACTCACATTCTCATCATGG + Intronic
964060627 3:152518026-152518048 GTGGACATACACACACATCCAGG - Intergenic
966634536 3:182117696-182117718 GTTTGCACACAGTGTCATCCTGG + Intergenic
967351816 3:188522330-188522352 GTGCACACACACGCTCACACTGG - Intronic
967989296 3:195119559-195119581 GTGTAAACACACTCCTAGCCCGG + Intronic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
968264523 3:197352527-197352549 GTGAAGCCACAGTCTCATCCTGG + Intergenic
968489867 4:884208-884230 GTGCACACACACGTTCCTCCTGG - Intronic
970380340 4:15501112-15501134 GTTTAAACACACACTCAACCTGG - Intronic
970383901 4:15537079-15537101 GTGTAAACAAACACTCAGCCTGG + Intronic
974907558 4:68076930-68076952 GTGTACACACACTGGCACACAGG + Intronic
976866283 4:89731364-89731386 TTGTACACACCCACTCACCCAGG - Intronic
977269001 4:94891579-94891601 GTGGCCACACATTCTAATCCTGG + Intronic
983144094 4:164190563-164190585 GTGAACACACACCCTAACCCAGG - Intronic
985303049 4:188509610-188509632 TGGAACACACACTCTCTTCCAGG - Intergenic
985949513 5:3212721-3212743 GTGTGCACAGACTGGCATCCGGG - Intergenic
989669210 5:43894762-43894784 GTGCACACACCCACCCATCCTGG + Intergenic
990252921 5:53935272-53935294 CTTTACACCCACCCTCATCCAGG + Intronic
990731325 5:58812151-58812173 CTGAACACACAGTCACATCCAGG - Intronic
991433913 5:66576577-66576599 TTCTACCCACAGTCTCATCCTGG + Intergenic
996470974 5:123860123-123860145 GAGTCCACACACTCCCTTCCAGG + Intergenic
1002635900 5:180608653-180608675 GGGCACACACACTCTCCTCCAGG - Intronic
1004122748 6:12840553-12840575 CTGGACCCACTCTCTCATCCAGG + Intronic
1005560224 6:27032566-27032588 GTCTACACACACCTTCATCATGG + Intergenic
1006922561 6:37636347-37636369 CTGTACACACCCTCCTATCCAGG + Exonic
1007598097 6:43064131-43064153 GAAAACACACACTCTCAGCCAGG - Intronic
1012396431 6:98803013-98803035 ATGTGCACACACACGCATCCTGG - Intergenic
1014943396 6:127469795-127469817 GTGTACACACAGGCACAACCGGG + Intronic
1017094085 6:150788842-150788864 GTGCACACACACTCACTCCCTGG - Intronic
1020306451 7:6839512-6839534 GTGTACACCCACTGTGATACTGG - Intergenic
1020312357 7:6878192-6878214 GTGTACACTCACTCTGATATTGG - Intergenic
1020368409 7:7405252-7405274 GTGTACACACACTCTTTGCCAGG - Intronic
1023777754 7:43625109-43625131 TTGTACACAAATTCTCATTCTGG - Exonic
1029648665 7:101875117-101875139 TTGTACACACCCTCTCTTACCGG + Intronic
1034266124 7:149781663-149781685 GTGTACACACAGACACATACAGG + Intergenic
1034896370 7:154878842-154878864 GTGTACACACACAGACACCCTGG + Intronic
1035620595 8:1033816-1033838 GTGGATTCACACGCTCATCCCGG + Intergenic
1035758508 8:2051813-2051835 GTGTACACACACTTGCACACAGG - Intronic
1035837041 8:2765443-2765465 GTGTCCACACAGTCACAGCCTGG + Intergenic
1036819939 8:11932319-11932341 GTGTACACCCCCTTTCATACTGG - Intergenic
1036905446 8:12705200-12705222 GTGTACACCCACTGTCATACTGG - Intergenic
1037555669 8:20019807-20019829 ATGCACACACACGCACATCCTGG - Intergenic
1038639781 8:29314510-29314532 GTGTACACCCACTGTCATTTAGG - Intergenic
1039625382 8:39045453-39045475 GTGTACACACACGCACATATAGG - Intronic
1040854555 8:51935135-51935157 GTGTGCCAACACTCTCACCCTGG - Intergenic
1045049704 8:98311654-98311676 GTGCACACACACACTCCTCCTGG - Intergenic
1047058203 8:121192009-121192031 GTCTACACATAATATCATCCTGG - Intergenic
1047138943 8:122113632-122113654 ATGTACACAAACTCTGGTCCTGG + Intergenic
1049946857 9:605446-605468 GTGTACGCACTTTCTCCTCCAGG - Intronic
1050692931 9:8248926-8248948 GTCTACACATTCTCTCATCCAGG + Intergenic
1051366338 9:16324119-16324141 GTGTCCCCACCCTCTCAACCAGG + Intergenic
1055080569 9:72264531-72264553 GTATACACACTCTCTAATCTCGG - Intergenic
1056866403 9:90230541-90230563 GTGTACACCCACTGTGATACTGG + Intergenic
1057254237 9:93531181-93531203 GTGTTCTAACACTCTCATCTAGG - Intronic
1058519089 9:105801726-105801748 GTGTGTACACACTCTGATACTGG - Intergenic
1060640735 9:125236340-125236362 GTGAACACACACCCTAACCCAGG + Exonic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1187909759 X:24100812-24100834 CTGTATACACAGTCTCAGCCAGG + Intergenic
1188951080 X:36376029-36376051 GTGTACACACACTCAGCTGCAGG + Intronic
1189462307 X:41252810-41252832 GTGCACACACACCCTCTGCCTGG + Intergenic
1192546798 X:72021020-72021042 GTGTACACACCCTCACCTCTAGG - Intergenic