ID: 1122321067

View in Genome Browser
Species Human (GRCh38)
Location 14:100856176-100856198
Sequence GAACACTCCATAGGCAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122321063_1122321067 0 Left 1122321063 14:100856153-100856175 CCTCCCGTGCAGGGGTCTGCATA No data
Right 1122321067 14:100856176-100856198 GAACACTCCATAGGCAAACCTGG No data
1122321064_1122321067 -3 Left 1122321064 14:100856156-100856178 CCCGTGCAGGGGTCTGCATAGAA No data
Right 1122321067 14:100856176-100856198 GAACACTCCATAGGCAAACCTGG No data
1122321065_1122321067 -4 Left 1122321065 14:100856157-100856179 CCGTGCAGGGGTCTGCATAGAAC No data
Right 1122321067 14:100856176-100856198 GAACACTCCATAGGCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122321067 Original CRISPR GAACACTCCATAGGCAAACC TGG Intergenic
No off target data available for this crispr