ID: 1122321903

View in Genome Browser
Species Human (GRCh38)
Location 14:100860482-100860504
Sequence CAGGGTACGCCAGAAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122321895_1122321903 15 Left 1122321895 14:100860444-100860466 CCAGAAGTTTCTGCAAGTGGGCC No data
Right 1122321903 14:100860482-100860504 CAGGGTACGCCAGAAGTTGAGGG No data
1122321901_1122321903 -6 Left 1122321901 14:100860465-100860487 CCGAGTCTAAGGTAGGGCAGGGT No data
Right 1122321903 14:100860482-100860504 CAGGGTACGCCAGAAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122321903 Original CRISPR CAGGGTACGCCAGAAGTTGA GGG Intergenic
No off target data available for this crispr