ID: 1122329884

View in Genome Browser
Species Human (GRCh38)
Location 14:100904879-100904901
Sequence TCTCGGGCCCCTCGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122329884_1122329891 8 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329891 14:100904910-100904932 CGGGGCCAGAAAGAGAAGAGTGG No data
1122329884_1122329894 11 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329894 14:100904913-100904935 GGCCAGAAAGAGAAGAGTGGGGG No data
1122329884_1122329899 22 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329899 14:100904924-100904946 GAAGAGTGGGGGAGGAGGCCGGG No data
1122329884_1122329898 21 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329898 14:100904923-100904945 AGAAGAGTGGGGGAGGAGGCCGG No data
1122329884_1122329897 17 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329897 14:100904919-100904941 AAAGAGAAGAGTGGGGGAGGAGG No data
1122329884_1122329896 14 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329896 14:100904916-100904938 CAGAAAGAGAAGAGTGGGGGAGG No data
1122329884_1122329888 -10 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329888 14:100904892-100904914 GGGCCCGAGACTCTGCAGCGGGG No data
1122329884_1122329900 27 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329900 14:100904929-100904951 GTGGGGGAGGAGGCCGGGAGTGG No data
1122329884_1122329892 9 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329892 14:100904911-100904933 GGGGCCAGAAAGAGAAGAGTGGG No data
1122329884_1122329893 10 Left 1122329884 14:100904879-100904901 CCAGGAAGCCGAGGGGCCCGAGA No data
Right 1122329893 14:100904912-100904934 GGGCCAGAAAGAGAAGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122329884 Original CRISPR TCTCGGGCCCCTCGGCTTCC TGG (reversed) Intergenic
No off target data available for this crispr