ID: 1122334678

View in Genome Browser
Species Human (GRCh38)
Location 14:100963686-100963708
Sequence CCCACGGACCAGGGCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122334678_1122334691 23 Left 1122334678 14:100963686-100963708 CCCTCCCTGCCCTGGTCCGTGGG No data
Right 1122334691 14:100963732-100963754 TCCTGGGTGCCAAAAATGTTGGG No data
1122334678_1122334690 22 Left 1122334678 14:100963686-100963708 CCCTCCCTGCCCTGGTCCGTGGG No data
Right 1122334690 14:100963731-100963753 ATCCTGGGTGCCAAAAATGTTGG No data
1122334678_1122334693 24 Left 1122334678 14:100963686-100963708 CCCTCCCTGCCCTGGTCCGTGGG No data
Right 1122334693 14:100963733-100963755 CCTGGGTGCCAAAAATGTTGGGG No data
1122334678_1122334687 7 Left 1122334678 14:100963686-100963708 CCCTCCCTGCCCTGGTCCGTGGG No data
Right 1122334687 14:100963716-100963738 TCTTCTACAAAACCCATCCTGGG No data
1122334678_1122334686 6 Left 1122334678 14:100963686-100963708 CCCTCCCTGCCCTGGTCCGTGGG No data
Right 1122334686 14:100963715-100963737 CTCTTCTACAAAACCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122334678 Original CRISPR CCCACGGACCAGGGCAGGGA GGG (reversed) Intergenic
No off target data available for this crispr