ID: 1122337785

View in Genome Browser
Species Human (GRCh38)
Location 14:101005299-101005321
Sequence TGATGAAACTTGAGTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122337784_1122337785 -1 Left 1122337784 14:101005277-101005299 CCGAGGTCTGGTTTTGCTTCTCT No data
Right 1122337785 14:101005299-101005321 TGATGAAACTTGAGTGAGCTTGG No data
1122337781_1122337785 28 Left 1122337781 14:101005248-101005270 CCTAGGCTGATGGTTTGTGAGAC No data
Right 1122337785 14:101005299-101005321 TGATGAAACTTGAGTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122337785 Original CRISPR TGATGAAACTTGAGTGAGCT TGG Intergenic
No off target data available for this crispr