ID: 1122337953

View in Genome Browser
Species Human (GRCh38)
Location 14:101006212-101006234
Sequence ATTTCTCCCAGCGCGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122337953_1122337958 -6 Left 1122337953 14:101006212-101006234 CCAGAGACCGCGCTGGGAGAAAT No data
Right 1122337958 14:101006229-101006251 AGAAATCAGGGGTTCACTCCTGG No data
1122337953_1122337960 1 Left 1122337953 14:101006212-101006234 CCAGAGACCGCGCTGGGAGAAAT No data
Right 1122337960 14:101006236-101006258 AGGGGTTCACTCCTGGTCGGAGG No data
1122337953_1122337959 -2 Left 1122337953 14:101006212-101006234 CCAGAGACCGCGCTGGGAGAAAT No data
Right 1122337959 14:101006233-101006255 ATCAGGGGTTCACTCCTGGTCGG No data
1122337953_1122337963 29 Left 1122337953 14:101006212-101006234 CCAGAGACCGCGCTGGGAGAAAT No data
Right 1122337963 14:101006264-101006286 ATCTGCCTCTGCATGTAGGAAGG No data
1122337953_1122337962 25 Left 1122337953 14:101006212-101006234 CCAGAGACCGCGCTGGGAGAAAT No data
Right 1122337962 14:101006260-101006282 GAGCATCTGCCTCTGCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122337953 Original CRISPR ATTTCTCCCAGCGCGGTCTC TGG (reversed) Intergenic
No off target data available for this crispr