ID: 1122341874

View in Genome Browser
Species Human (GRCh38)
Location 14:101033861-101033883
Sequence CCCCGACGGGACCCTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122341868_1122341874 -6 Left 1122341868 14:101033844-101033866 CCTTGAAGTGCCTCCATCCCCGA No data
Right 1122341874 14:101033861-101033883 CCCCGACGGGACCCTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122341874 Original CRISPR CCCCGACGGGACCCTGAGCA TGG Intergenic
No off target data available for this crispr