ID: 1122343554

View in Genome Browser
Species Human (GRCh38)
Location 14:101044353-101044375
Sequence ATGGCCTGGCTTCCATGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122343546_1122343554 2 Left 1122343546 14:101044328-101044350 CCTCGGATGTCAGCCCCTCTCAG No data
Right 1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG No data
1122343545_1122343554 13 Left 1122343545 14:101044317-101044339 CCAGGACAAAGCCTCGGATGTCA No data
Right 1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG No data
1122343542_1122343554 25 Left 1122343542 14:101044305-101044327 CCCTGCTTGTCTCCAGGACAAAG No data
Right 1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG No data
1122343543_1122343554 24 Left 1122343543 14:101044306-101044328 CCTGCTTGTCTCCAGGACAAAGC No data
Right 1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122343554 Original CRISPR ATGGCCTGGCTTCCATGTCC GGG Intergenic
No off target data available for this crispr