ID: 1122344187

View in Genome Browser
Species Human (GRCh38)
Location 14:101048109-101048131
Sequence GTCCAAGGAAATCACACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122344187_1122344195 12 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344195 14:101048144-101048166 TGGGGTGGAGATGCCATTTAGGG No data
1122344187_1122344192 -6 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344192 14:101048126-101048148 TTGGACAAATGCTAGCTTTGGGG No data
1122344187_1122344191 -7 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344191 14:101048125-101048147 CTTGGACAAATGCTAGCTTTGGG No data
1122344187_1122344196 13 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344196 14:101048145-101048167 GGGGTGGAGATGCCATTTAGGGG No data
1122344187_1122344197 18 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344197 14:101048150-101048172 GGAGATGCCATTTAGGGGCTTGG No data
1122344187_1122344193 -3 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344193 14:101048129-101048151 GACAAATGCTAGCTTTGGGGTGG No data
1122344187_1122344190 -8 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344190 14:101048124-101048146 CCTTGGACAAATGCTAGCTTTGG No data
1122344187_1122344194 11 Left 1122344187 14:101048109-101048131 CCACCAGTGTGATTTCCTTGGAC No data
Right 1122344194 14:101048143-101048165 TTGGGGTGGAGATGCCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122344187 Original CRISPR GTCCAAGGAAATCACACTGG TGG (reversed) Intergenic
No off target data available for this crispr