ID: 1122345443

View in Genome Browser
Species Human (GRCh38)
Location 14:101055877-101055899
Sequence CCTTACAGGAATTCTCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122345443_1122345451 0 Left 1122345443 14:101055877-101055899 CCCTCCAGAGAATTCCTGTAAGG No data
Right 1122345451 14:101055900-101055922 GAATCCCAGGTTTACCAAGGAGG No data
1122345443_1122345450 -3 Left 1122345443 14:101055877-101055899 CCCTCCAGAGAATTCCTGTAAGG No data
Right 1122345450 14:101055897-101055919 AGGGAATCCCAGGTTTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122345443 Original CRISPR CCTTACAGGAATTCTCTGGA GGG (reversed) Intergenic
No off target data available for this crispr