ID: 1122346476

View in Genome Browser
Species Human (GRCh38)
Location 14:101064203-101064225
Sequence CTGGAGAGGGCTCCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122346476_1122346487 4 Left 1122346476 14:101064203-101064225 CCTGCAGCCGGAGCCCTCTCCAG No data
Right 1122346487 14:101064230-101064252 GGTGCCTGAGGGCCGCCCATGGG No data
1122346476_1122346493 26 Left 1122346476 14:101064203-101064225 CCTGCAGCCGGAGCCCTCTCCAG No data
Right 1122346493 14:101064252-101064274 GACAGGCCCGATTGTACCCACGG No data
1122346476_1122346483 -8 Left 1122346476 14:101064203-101064225 CCTGCAGCCGGAGCCCTCTCCAG No data
Right 1122346483 14:101064218-101064240 CTCTCCAGGGCAGGTGCCTGAGG No data
1122346476_1122346484 -7 Left 1122346476 14:101064203-101064225 CCTGCAGCCGGAGCCCTCTCCAG No data
Right 1122346484 14:101064219-101064241 TCTCCAGGGCAGGTGCCTGAGGG No data
1122346476_1122346486 3 Left 1122346476 14:101064203-101064225 CCTGCAGCCGGAGCCCTCTCCAG No data
Right 1122346486 14:101064229-101064251 AGGTGCCTGAGGGCCGCCCATGG No data
1122346476_1122346489 9 Left 1122346476 14:101064203-101064225 CCTGCAGCCGGAGCCCTCTCCAG No data
Right 1122346489 14:101064235-101064257 CTGAGGGCCGCCCATGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122346476 Original CRISPR CTGGAGAGGGCTCCGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr