ID: 1122347920

View in Genome Browser
Species Human (GRCh38)
Location 14:101071860-101071882
Sequence CTGTACAAACAGTTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122347909_1122347920 15 Left 1122347909 14:101071822-101071844 CCAAGGCCTGGGGGAGCCCGCCA 0: 1
1: 0
2: 6
3: 38
4: 339
Right 1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 144
1122347910_1122347920 9 Left 1122347910 14:101071828-101071850 CCTGGGGGAGCCCGCCAGCCTGC 0: 1
1: 0
2: 2
3: 33
4: 370
Right 1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 144
1122347914_1122347920 -9 Left 1122347914 14:101071846-101071868 CCTGCTGAGTTCTACTGTACAAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 144
1122347911_1122347920 -1 Left 1122347911 14:101071838-101071860 CCCGCCAGCCTGCTGAGTTCTAC 0: 1
1: 0
2: 1
3: 8
4: 170
Right 1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 144
1122347913_1122347920 -5 Left 1122347913 14:101071842-101071864 CCAGCCTGCTGAGTTCTACTGTA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 144
1122347912_1122347920 -2 Left 1122347912 14:101071839-101071861 CCGCCAGCCTGCTGAGTTCTACT 0: 1
1: 0
2: 2
3: 13
4: 188
Right 1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 144
1122347908_1122347920 19 Left 1122347908 14:101071818-101071840 CCTGCCAAGGCCTGGGGGAGCCC 0: 1
1: 0
2: 7
3: 52
4: 427
Right 1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122347920 Original CRISPR CTGTACAAACAGTTGGGGAG GGG Intergenic
906491719 1:46273787-46273809 CTAGACAGACAGTAGGGGAGGGG - Intronic
915109525 1:153554202-153554224 CTGCACAGAGATTTGGGGAGAGG + Intergenic
915508764 1:156374260-156374282 CTGGACAAATGGTTGGGGGGTGG - Intronic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
922023843 1:221732206-221732228 CTGTACAAACTTGTGGGCAGAGG - Intronic
922443487 1:225677053-225677075 GCCTACAAACAGGTGGGGAGGGG + Intergenic
924563256 1:245174670-245174692 CTGTAAAAATAGTTGCTGAGGGG - Intronic
1064058121 10:12115083-12115105 CTGTTCAAACAGGCCGGGAGCGG - Intronic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1072808254 10:98439341-98439363 CTGTGAAAACAGCTGGGAAGAGG + Intronic
1074658660 10:115624689-115624711 CTGTCCAAACAGTGGGGGAGGGG - Intronic
1075574351 10:123568023-123568045 CTGTGCAAGCAGTCGAGGAGGGG + Intergenic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1083879701 11:65542041-65542063 CTGAGCACAGAGTTGGGGAGTGG - Intronic
1086095078 11:83042070-83042092 CTGAACAAATAGTAGAGGAGTGG - Intronic
1086509259 11:87538899-87538921 CTGTTAAAAGAGTAGGGGAGGGG + Intergenic
1087634481 11:100687301-100687323 CTGTCAAGAGAGTTGGGGAGTGG + Intergenic
1089001994 11:115059867-115059889 CAGTACAAACAGTAGTGGAGGGG + Intergenic
1094524566 12:31223071-31223093 CTGTGCACACAGTTGGGATGAGG - Intergenic
1096490229 12:52008998-52009020 CTGTAGAGAAAGTTGAGGAGTGG + Intronic
1097105519 12:56621094-56621116 GTGTACAAAAAACTGGGGAGAGG - Intronic
1097995677 12:65885728-65885750 TTGGACAAAAATTTGGGGAGAGG - Intronic
1103680217 12:122687923-122687945 ATGTACACACGGTTGGAGAGAGG - Intergenic
1105894876 13:24709297-24709319 CTCTACCCACAGTAGGGGAGGGG - Intronic
1106595774 13:31134568-31134590 CTATACAAATATTTGGAGAGAGG - Intergenic
1109098894 13:58153295-58153317 CTGTACAATCAATTGAAGAGGGG - Intergenic
1111876499 13:93903783-93903805 TTTTAAAAACAGTTGGGGCGGGG - Intronic
1111966348 13:94865931-94865953 CTGTACAACCAGTTGGTAAGGGG + Intergenic
1112422433 13:99264707-99264729 CAATGCAAAGAGTTGGGGAGAGG - Intronic
1112553198 13:100442314-100442336 CTTTACAAACTGTGGGAGAGTGG + Intronic
1112779416 13:102882780-102882802 GTGTACTAACAGCTGGAGAGAGG - Intergenic
1114223787 14:20720502-20720524 CGGTACACACAGTTGGGCATTGG - Intergenic
1114228158 14:20757412-20757434 CTGTACAAAGAGATGAGAAGAGG + Intergenic
1114360143 14:21962773-21962795 GTGTAAAACCAGTGGGGGAGAGG + Intergenic
1117787838 14:59305622-59305644 CTTTACAAGGAGTTGGGGGGTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG + Intergenic
1122619326 14:103045586-103045608 CTGTACAAGCATTGGAGGAGAGG - Intronic
1122926229 14:104903325-104903347 CAGCACAAAAAGTGGGGGAGAGG - Intergenic
1125108583 15:36003832-36003854 CTGGACAAAAAGTTGAGGATGGG + Intergenic
1127312795 15:57767441-57767463 CTGTACAATCACTTGGGGGCGGG + Intronic
1128426394 15:67545749-67545771 GTGAAAAAAAAGTTGGGGAGGGG + Intronic
1128881832 15:71251007-71251029 TTGTCCAAAGAGTTGGGGAAAGG - Intronic
1129392102 15:75225711-75225733 CAGAACAAACAATTGGGGTGGGG + Intergenic
1129472278 15:75762453-75762475 CAGAACAAACAATTGGGGTGGGG - Intergenic
1130181161 15:81629899-81629921 CTGAAGAAACAGCTGGGAAGAGG - Intergenic
1135788578 16:25372754-25372776 CTGTTCAGTCAGTTGGGGATGGG - Intergenic
1138161030 16:54754575-54754597 CAGGCCAAACTGTTGGGGAGAGG - Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1141089095 16:81117659-81117681 CTGTGCACAAGGTTGGGGAGAGG - Intergenic
1142439550 16:90086916-90086938 CTGTAAAAACAGTCGGTGACTGG - Intronic
1143648805 17:8249746-8249768 CTGTCCTGAAAGTTGGGGAGGGG + Intronic
1144440228 17:15274599-15274621 CTGTAGAAAGAGCTGAGGAGGGG + Intergenic
1146787645 17:35732822-35732844 CAGTACAGGCAGGTGGGGAGTGG - Intronic
1147041710 17:37724361-37724383 CTGTCAGAACAGCTGGGGAGTGG - Intronic
1150782405 17:68134218-68134240 CTGGGCAAGGAGTTGGGGAGCGG + Intergenic
1151807733 17:76417024-76417046 CAGCACACACAGCTGGGGAGTGG - Intronic
1152958022 18:56741-56763 CTGTAAAAACAATTGGTGACTGG + Intronic
1155495661 18:26439379-26439401 CTGTTCAGAAAGTTGGGCAGGGG + Intergenic
1155691640 18:28631976-28631998 CTGTACAAACAGTTCTTGTGAGG + Intergenic
1156157847 18:34324725-34324747 CTTTACAAACAGTTGGTGGTAGG + Intergenic
1156710322 18:39936398-39936420 TAGTACAAAAAGTTGGGGAAAGG + Intergenic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1159314596 18:66755421-66755443 CTGCACAAACAGCTGATGAGCGG + Intergenic
1159494742 18:69188218-69188240 GTGAACAAAAATTTGGGGAGAGG - Intergenic
1160293909 18:77620541-77620563 TTGCACAAACAATTGGGGAGAGG - Intergenic
1160427877 18:78790708-78790730 GTGGACACACAGATGGGGAGCGG + Intergenic
1161914162 19:7216447-7216469 GTGTACCAGGAGTTGGGGAGAGG + Intronic
1162723423 19:12675756-12675778 CTGACCAAAAAGTAGGGGAGGGG + Exonic
1163704481 19:18804309-18804331 TTGTGCAAACAGGTGGGGTGGGG + Intergenic
1166990611 19:46690430-46690452 CTGTACAAAGACCTGGTGAGAGG - Intronic
1167287975 19:48609615-48609637 CTGGGCAAACAGTTTGGGGGTGG - Intronic
928366062 2:30704178-30704200 GTGTAAAAATAATTGGGGAGAGG - Intergenic
937319930 2:120955078-120955100 CAGTGCAAACAGTGGGGCAGTGG + Intronic
938767733 2:134471789-134471811 ATGCATAAACAGTTGGAGAGAGG + Intronic
938854924 2:135299478-135299500 CTGGACAAAAACCTGGGGAGGGG - Intronic
940031865 2:149272121-149272143 CGGGACAGACTGTTGGGGAGGGG + Intergenic
941174885 2:162184541-162184563 CGGGACAAACAGATGGGAAGAGG + Intronic
945116142 2:206409985-206410007 GAGTTCAAATAGTTGGGGAGTGG - Intergenic
1175074649 20:56362289-56362311 CTTTAAAAAATGTTGGGGAGAGG + Intronic
1176672140 21:9744859-9744881 GTGCACAAACAGCTGGGGGGGGG + Intergenic
1177265436 21:18777346-18777368 TTGTACAAAGATTTGGGGAATGG + Intergenic
1177391138 21:20474193-20474215 CTCCACAATCAGTTGAGGAGAGG - Intergenic
1178974693 21:37210837-37210859 CTGAAAAAAGAGATGGGGAGGGG - Intergenic
1179721626 21:43319442-43319464 CTGTACACACAGAGGGGGTGGGG + Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1184287356 22:43479083-43479105 CTCAACAGACAGCTGGGGAGGGG - Intronic
950691435 3:14661385-14661407 CTTTGTAAACATTTGGGGAGTGG + Intronic
951340082 3:21474927-21474949 CTGTACAAACAGCTAGAGAAAGG - Intronic
952341454 3:32451043-32451065 CAGTGCAGACAGTTGGGGACCGG + Intronic
954197050 3:49003096-49003118 CTGTGCTAACTGCTGGGGAGGGG + Intronic
955813589 3:62818494-62818516 CTGTTCAAACAGGTGTGGAGTGG - Intronic
957157550 3:76564695-76564717 CAGTACACACAGGTGGGGACAGG + Intronic
959942766 3:112096662-112096684 CAGAACAGAAAGTTGGGGAGGGG + Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962825726 3:139099767-139099789 CTCTACAAACCTTTGGGGTGGGG + Intronic
967236254 3:187386287-187386309 ATGGAGAAACTGTTGGGGAGTGG - Intergenic
967622833 3:191653937-191653959 CAGTCTAAAAAGTTGGGGAGAGG + Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
982022940 4:151222563-151222585 CTTTAAAAAAGGTTGGGGAGGGG - Intronic
984623590 4:181980142-181980164 CTTTTCAAACAGTGGAGGAGGGG + Intergenic
985402596 4:189606989-189607011 GTGCACAAACAGCTGGGGGGGGG - Intergenic
986139998 5:5020533-5020555 ATGTAGAAAGTGTTGGGGAGAGG + Intergenic
986813932 5:11387299-11387321 CTGAACAAACTCTGGGGGAGGGG + Intronic
990499952 5:56386133-56386155 CAGTACAATCAGTTGGTGAGTGG + Intergenic
990603140 5:57381450-57381472 ATGGACAAACTGTTTGGGAGGGG + Intergenic
991543009 5:67750711-67750733 CTGAACATAGAGTTGGGAAGAGG - Intergenic
992181271 5:74200622-74200644 CTGTACATACAGTGGTGGCGAGG + Intergenic
993909422 5:93663269-93663291 CTGTAAAAACAGTTTGGCACAGG - Intronic
994112552 5:96023159-96023181 CTGCACAAGCAGTAGGGAAGTGG - Intergenic
995207222 5:109494684-109494706 CTCAAAAAAAAGTTGGGGAGAGG - Intergenic
999420954 5:151442666-151442688 CTGTACAAACAGTAGAACAGAGG - Intronic
1000581086 5:163035898-163035920 CTGTGGAAACAGCTGGGAAGGGG + Intergenic
1005869987 6:29967708-29967730 CTGTACAAACAGCTGATCAGGGG + Intergenic
1006698461 6:35951949-35951971 CTCTACAAACATTTGATGAGTGG + Intronic
1006812210 6:36827273-36827295 CTGGACAGGCAGTTAGGGAGAGG - Intronic
1009626902 6:66146175-66146197 CTGCACTCACCGTTGGGGAGGGG + Intergenic
1011818537 6:91222903-91222925 CTGTGCAAATAGTTGGGTGGAGG + Intergenic
1016103187 6:140128443-140128465 CTGTTCCATCAGTTGGGGTGAGG - Intergenic
1016932680 6:149425979-149426001 CTATACAACCAGTTAAGGAGGGG - Intergenic
1018811334 6:167300403-167300425 TTGTAGAATCAGCTGGGGAGGGG + Intronic
1018972819 6:168540344-168540366 CTGGACACGCAGCTGGGGAGAGG - Intronic
1019152410 6:170017534-170017556 CTGTAAAAGCTGTTGGTGAGAGG + Intergenic
1019510145 7:1413743-1413765 CTGTACAATGGGTTGGGGCGGGG + Intergenic
1020003770 7:4770829-4770851 CTGTAAAAATAATTTGGGAGGGG + Exonic
1021480100 7:21106253-21106275 CTCTTCAAAGAGTTGGGGAAAGG - Intergenic
1024700796 7:51902040-51902062 CTGGACTCACAGCTGGGGAGGGG + Intergenic
1030724220 7:112906397-112906419 CTGTATAAACAGAAGGGAAGGGG + Intronic
1031713042 7:125073112-125073134 CAGATCAAACACTTGGGGAGGGG + Intergenic
1034733054 7:153404708-153404730 CTGTTCAAAAAGTGGGGAAGAGG + Intergenic
1035895423 8:3394617-3394639 GTGTAGAAAAAGTTGGGGGGAGG + Intronic
1039525524 8:38212013-38212035 CAATACAAACAGATGAGGAGAGG + Exonic
1040858832 8:51978278-51978300 CTCAACAAACATTTGTGGAGTGG - Intergenic
1041274790 8:56145794-56145816 TTGTATAAAAAGTAGGGGAGGGG + Intergenic
1046970764 8:120220685-120220707 GTCTCCAAAAAGTTGGGGAGAGG - Intronic
1049360835 8:142211905-142211927 CTGTGCTCACAGCTGGGGAGGGG - Intergenic
1049583198 8:143421906-143421928 CTGTACCAAGAGCTGGGCAGAGG + Intronic
1050462034 9:5885274-5885296 ATGTACAAACAGTTCGGAGGGGG - Intronic
1050763911 9:9108974-9108996 CTTTGCAAAGAGTGGGGGAGAGG - Intronic
1055778232 9:79790070-79790092 CTGTGGAAACAGTAGGAGAGGGG - Intergenic
1057157231 9:92853727-92853749 CAGTATAACCAGTTGGGAAGAGG + Intronic
1057868885 9:98702924-98702946 CTGAACACAGAGTTGGGGAGAGG - Intronic
1059841712 9:118224482-118224504 TTGGTCAAACAGATGGGGAGTGG - Intergenic
1059993771 9:119889849-119889871 TTTTACATAGAGTTGGGGAGGGG + Intergenic
1060222898 9:121773825-121773847 CTGTGAAAACATTTTGGGAGGGG - Intronic
1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG + Intergenic
1186192198 X:7076792-7076814 CTCTATAAGCAGTTGGGGAGGGG + Intronic
1188509336 X:30917910-30917932 ATGTACATACATGTGGGGAGTGG - Intronic
1190584394 X:51923782-51923804 CTGGGCAAACAGCTGGCGAGTGG - Intergenic
1194909919 X:99629746-99629768 CTGTATATACAGTTGGGAAGAGG - Intergenic
1195457408 X:105084327-105084349 CTGTGAAAACAGCTGGGGACCGG + Intronic
1195941748 X:110173113-110173135 CTTTATAAACAGGTGGGGATTGG + Intronic
1197746810 X:129936984-129937006 CTCCACAGACAGTTGTGGAGAGG - Intergenic
1199470853 X:148194005-148194027 CTATACTAACAGGTGGGGAGTGG + Intergenic
1200111802 X:153744345-153744367 CTGTAGAAAGAGGTGGTGAGGGG - Exonic
1200176880 X:154123238-154123260 CTCTCCACACAGTTGGGGACTGG + Intergenic
1201564153 Y:15348241-15348263 CTCTATAAGCAGTTGGGGAGGGG + Intergenic