ID: 1122347970

View in Genome Browser
Species Human (GRCh38)
Location 14:101072149-101072171
Sequence CCCAGCAGCCAGGTGTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122347970 Original CRISPR CCCAGCAGCCAGGTGTCTAT AGG Intergenic
902626525 1:17679817-17679839 CCCACCTGCCAGGTGTCTGTGGG + Intronic
903127006 1:21255079-21255101 TCCAGCTGACAGGTGTATATGGG - Intronic
903189545 1:21649091-21649113 CCCAGCAGGCAGGTGCCTCCGGG - Intronic
903335261 1:22620294-22620316 CCCAGAACCCAGGTGTGTGTGGG - Intergenic
903787058 1:25868314-25868336 CCCAGGAGCTAGGTGTCCACAGG - Intronic
905947640 1:41917362-41917384 CACAGCAGCCAGGTGCCCACTGG - Intronic
907458762 1:54592903-54592925 CTCAGCAGCCAGGTTTTTGTGGG + Intronic
907885272 1:58587011-58587033 CCCAGGTGCCAGGTCTGTATTGG + Intergenic
907891700 1:58642698-58642720 CCAAACAGCCAGGCATCTATTGG + Intergenic
910135492 1:83963640-83963662 CCTAGCAGCCAGTTGTCTCATGG - Intronic
910831642 1:91467323-91467345 CCAAGTAGACAGGTGTCTACAGG - Intergenic
913653469 1:120939987-120940009 CCCAGTGGCCAGGCATCTATCGG - Intergenic
914167628 1:145189041-145189063 CCCAGTGGCCAGGCATCTATCGG + Intergenic
914519160 1:148400111-148400133 CCCAGTGGCCAGGCATCTATCGG - Intergenic
914643653 1:149634146-149634168 CCCAGTGGCCAGGCATCTATCGG - Intergenic
916016073 1:160750885-160750907 CCCAGGAGCCATGTGTCTAGTGG - Intronic
920647425 1:207813846-207813868 CCCACCAGCCGGCTGTCTGTGGG - Intergenic
924112789 1:240716208-240716230 CCCTCCAGCCAGGTGTCGATAGG + Intergenic
1065390599 10:25176903-25176925 CCCAGCAGCTAGCTGTCTCTGGG + Intronic
1067451437 10:46384398-46384420 CCCAGCAGCCAGGGCTCATTGGG + Intronic
1067585804 10:47475358-47475380 CCCAGCAGCCAGGGCTCATTGGG - Intronic
1070328003 10:75400428-75400450 CCCAGAAGCCAGGATTCTAAAGG - Intronic
1070599613 10:77856635-77856657 CCCAGGAGCCAGGGGTGTTTGGG + Intronic
1071737602 10:88318714-88318736 CCCAGCTGCAATGTGGCTATGGG - Intronic
1072552080 10:96486836-96486858 CCCAGCAGCCCTGTGACTTTGGG - Intronic
1072929682 10:99651083-99651105 CCCAGCATCCAGGAGCCTCTTGG + Intergenic
1076794684 10:132792839-132792861 CCCAGCAGCCAGGGGTCCCAGGG - Intergenic
1077181875 11:1220492-1220514 CCCAGCACCCAGGTGGGCATCGG + Intergenic
1077561096 11:3261834-3261856 CTTGGCAGCCAGGTGCCTATCGG + Intergenic
1077566992 11:3307664-3307686 CTTGGCAGCCAGGTGCCTATCGG + Intergenic
1077620034 11:3713200-3713222 TTCATCAGGCAGGTGTCTATTGG - Intronic
1079396675 11:20069535-20069557 CCCATCAGCCATGTCTGTATTGG + Intronic
1080148563 11:29020501-29020523 CCCAGCAGCCAGGGGGCTGATGG - Intergenic
1089074491 11:115727398-115727420 GTCAGCAGACAGCTGTCTATTGG - Intergenic
1089756491 11:120691338-120691360 CGCAGGGGCCTGGTGTCTATTGG - Intronic
1091236777 11:134027284-134027306 GCCAGCAGCCAGGTGACACTTGG + Intergenic
1095183956 12:39179482-39179504 CAAAGCAGCCAGGTGACTTTGGG + Intergenic
1104033110 12:125079291-125079313 CCCAGCAGCCAGGTCACCACGGG - Intronic
1104969206 12:132523582-132523604 CCCATCGGCCAGGTGTCCTTGGG + Intronic
1105280950 13:18962337-18962359 TCCAGCAGCCAGGTCCCTAGAGG + Intergenic
1105290146 13:19048349-19048371 TCCAGCAGCCAGGTCCCTAGAGG + Intergenic
1105496933 13:20938596-20938618 CCCGTCTGCCAGGTGTCTACCGG - Intergenic
1107690480 13:42948173-42948195 CCCAGCAGCCAGCTGGGTCTGGG + Intronic
1107979267 13:45718810-45718832 CCCCCCTGCCAGGTGTATATGGG + Intergenic
1110553892 13:76836885-76836907 CTCTGCAGACAGGTGTCTCTCGG - Intergenic
1111711208 13:91816557-91816579 CCCAGCAGCCAGCTGTTTCCTGG + Intronic
1113896731 13:113769254-113769276 CCCAGCACACTGGTGTCTACAGG + Intronic
1114805126 14:25826516-25826538 CAGAGCAGGCAGCTGTCTATGGG + Intergenic
1117552015 14:56846133-56846155 CCCAGGAGCCATTTGTCTACAGG - Intergenic
1121181558 14:91932908-91932930 CTCAGCAGCCTGTTGTCTGTTGG - Intronic
1122347970 14:101072149-101072171 CCCAGCAGCCAGGTGTCTATAGG + Intergenic
1123774153 15:23561723-23561745 CACAGCAGTCAGATTTCTATAGG - Intergenic
1125601403 15:40917758-40917780 CTCCGCAGCCAGGTGGCTACTGG - Intergenic
1127625532 15:60776459-60776481 CCCAGCACCCAGCTCTCTGTAGG - Intronic
1129159765 15:73740725-73740747 CTCATCAGCCAGGGGTCTACAGG - Intronic
1131378898 15:91947815-91947837 CCTAGCAGCCAGGTGACTTTGGG + Intronic
1131509937 15:93044359-93044381 CACAGCAGCCAGGTGAACATGGG + Intronic
1132920211 16:2385427-2385449 CCCAGCATATTGGTGTCTATTGG + Intergenic
1133031692 16:3014140-3014162 CCCTGCAGCCAGGTGTAGCTTGG - Exonic
1133747273 16:8696750-8696772 CCCAGCAGCCGGGTGCCTGGGGG + Intronic
1134829720 16:17313292-17313314 CCCAGCAGCCAGGGGCCTGGAGG - Intronic
1135975583 16:27107227-27107249 CTCGGCAGCCAGGCGCCTATGGG + Intergenic
1136085199 16:27880043-27880065 GCCAGCAGCCAGGTCTATCTGGG - Intronic
1138606803 16:58094974-58094996 CCCAGCACCCATGGGTCTAGGGG - Intergenic
1139505377 16:67395812-67395834 CCCAGCCCCCATGGGTCTATAGG + Intronic
1140127257 16:72128486-72128508 CTCAGCAACCAGGTGCCAATGGG + Intronic
1141110420 16:81266912-81266934 CCCACCAGCCAGCTGTTTACAGG + Intronic
1141864092 16:86737928-86737950 GTAAGCAGCCAGGTGTCTGTTGG + Intergenic
1141887795 16:86904635-86904657 CCCAGCACACAGGTATCTCTGGG + Intergenic
1143782516 17:9236718-9236740 CCCGGCAGCAAGGTGTCCAGAGG + Intronic
1148469577 17:47884896-47884918 CCCAGCTGCCAGTTTTCTCTAGG + Intergenic
1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG + Intergenic
1150389912 17:64784258-64784280 CCCAGCTGCCTGCTGTCTCTAGG + Intergenic
1152154964 17:78626969-78626991 CCCAGGATCCAGGTGTCAGTAGG - Intergenic
1152814238 17:82398014-82398036 CCCAGGAGGCTGGTGTCTACGGG - Intronic
1153619683 18:6965548-6965570 CCCCACAGCCAGAGGTCTATCGG + Intronic
1156254265 18:35380038-35380060 CACAGCTGCCATGTTTCTATAGG + Intergenic
1159001672 18:62980455-62980477 CTCAGCAGCCAGATGTTTCTTGG + Intergenic
1159042560 18:63338464-63338486 GAAAGCAGCCAGGTGTATATGGG + Intronic
1160294200 18:77622668-77622690 CCCAGCAGCCAGGAGCCATTAGG + Intergenic
1161084778 19:2329801-2329823 CCCAGCAGCCAGGTCACAACTGG - Intronic
1161140908 19:2647247-2647269 CCCAGCACCCACGTTCCTATGGG - Intronic
1162906213 19:13825666-13825688 CCCAGCAGCGTGGTGTCTGGTGG - Exonic
1163996497 19:21053218-21053240 CCCAGTAGCCAGGCGCCTATAGG - Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1168097692 19:54124830-54124852 CCCACCAGTCAGGTGACTGTGGG + Intronic
1168523646 19:57071694-57071716 CCCAGGAGCCAGGTGGGGATGGG + Intergenic
1168598384 19:57697267-57697289 CCCAGCAGACAGGTGTGTGATGG - Intronic
924980446 2:214581-214603 CCGAGCAGCCCGGTGCCTGTTGG - Intergenic
928317678 2:30258598-30258620 CCCAGCAGCCATGGGTACATGGG + Exonic
930724355 2:54667962-54667984 GCCAGCAGCCAGCTGTTTAATGG + Intronic
931244227 2:60479275-60479297 CGCAGAGGCCAGGTGTCCATAGG - Intronic
931312952 2:61099959-61099981 TCCAGAAGCCAGGTTTTTATGGG + Intronic
931872152 2:66472867-66472889 GTCAGCAGCCAGGTGACTAATGG - Intronic
932442730 2:71748107-71748129 CACAGCAGCCAGGACTCCATGGG - Intergenic
933822673 2:86128535-86128557 CTCAGTAGCCATGTGTCTAGTGG + Intronic
934614746 2:95764081-95764103 CCCTGTAGGCAGGTGTCTTTGGG + Intergenic
936715541 2:115182957-115182979 CCCAGCAGCCTGTTGTCCATGGG - Intronic
937812362 2:126213121-126213143 CCCATCAGCCAGGTCACTCTGGG - Intergenic
938092115 2:128440918-128440940 CCCAGCAGCCTGGTGACCACTGG + Intergenic
939949148 2:148447585-148447607 CCCATCAGCCTGGCCTCTATAGG - Intronic
940064508 2:149612045-149612067 CCCAGGAGCCAGGTGCCTTAAGG - Intergenic
943823313 2:192355893-192355915 CTCAGCATCCAGGTGTTTCTAGG - Intergenic
947690647 2:232132995-232133017 CCCAGCTGCTTGGTGTCTCTGGG - Intronic
948982890 2:241503862-241503884 CCCAGCACACAGGTGTCCAGGGG - Intronic
1169632377 20:7647688-7647710 CACAGCACCCAGGTGCCTGTAGG + Intergenic
1173684125 20:44910623-44910645 CCCAGCAGCCGTGTGACTCTGGG + Intronic
1173982664 20:47236848-47236870 CTCAGCATCCCAGTGTCTATGGG + Intronic
1174579147 20:51558700-51558722 CCCAGCAGAGAAGTGTCTAGGGG + Intronic
1176304961 21:5118518-5118540 CACCGCAGCCATGTGTCTAAGGG - Intronic
1178488864 21:33035321-33035343 CCAAGCAGCCAGGAATCTGTAGG + Intergenic
1179852094 21:44143512-44143534 CACCGCAGCCATGTGTCTAAGGG + Intronic
1183246674 22:36699204-36699226 CCCAGCAGGCTGGTGTCCTTAGG - Intronic
1183464415 22:37972562-37972584 CCCAGCACCCAGGTTGCTGTCGG - Exonic
949866985 3:8554612-8554634 CCCACCAGCCTGGTGTGAATGGG - Intronic
956899133 3:73695704-73695726 CTCAGCAGCCACTTGTGTATTGG - Intergenic
958918085 3:100071876-100071898 CCCATCAACCAGGTGTCTTCAGG + Intronic
964690145 3:159441456-159441478 CCAAGCAGCCAGGTTTTTTTTGG + Intronic
977151390 4:93516972-93516994 CCCACCAGCCTGGTGTTAATGGG + Intronic
980955054 4:139419509-139419531 CCCAGCAGTCTGGTGTCTTCTGG - Intronic
987221164 5:15791867-15791889 CCCAGCAGCCAGATCTCTAAGGG - Intronic
992974030 5:82093835-82093857 CCCAGCAGCCATTAGTCTAGGGG + Intronic
996999930 5:129747433-129747455 CCCAGCAGCCATGTTTTTTTGGG + Intergenic
999174470 5:149622119-149622141 CCCATCAGCCAGCTGTGTGTAGG + Intronic
999269484 5:150288576-150288598 CCCTGGAGGCAGGTGTGTATTGG - Intronic
999940560 5:156537979-156538001 CCTTGCAGCCAGATTTCTATGGG + Intronic
1001686217 5:173596885-173596907 CTCAGCAGCCAGGTGACCTTGGG - Intergenic
1004509559 6:16274300-16274322 CCCAGCTGCCTGGTGGCTTTAGG + Intronic
1006315251 6:33287703-33287725 TCCAAAAGCCAGGTGTCTGTTGG + Exonic
1007032387 6:38640001-38640023 CCCAGCAGCCCGCTGTCGATCGG - Intronic
1007980945 6:46157659-46157681 GCCAGCTGCCAGGTATCTCTTGG + Intergenic
1009885440 6:69618672-69618694 CACAGCTGCCAGGTGTCTATCGG - Intergenic
1010275250 6:73961626-73961648 CCCAGCTGCCAGGTGAATCTAGG + Intergenic
1011333312 6:86234080-86234102 CCCACCAGCCCGCTGTCTCTGGG + Intergenic
1019299623 7:296530-296552 CCCAGCTGCCAGGAGTCTGGGGG + Intergenic
1019802441 7:3098116-3098138 CCCAGCAGCCTGGCCTCTCTAGG - Intergenic
1024250442 7:47502145-47502167 CCCAGAAGCTAGGTGACAATAGG + Intronic
1024446508 7:49485496-49485518 CCCAGCAGCTGTGTGTCTTTGGG + Intergenic
1024474347 7:49794511-49794533 CTCAGCAGGCAGGTATGTATGGG + Intronic
1031522849 7:122787594-122787616 TCCAGGAACCAGCTGTCTATTGG - Intronic
1032878294 7:136061592-136061614 CCCAGCAGCCAGGAGACAGTTGG - Intergenic
1034411964 7:150946646-150946668 CCCTGCACCCAGCTGTCTAGGGG + Intronic
1034572740 7:151970162-151970184 CCCAGCGGCCAGGCGTCTATTGG - Intronic
1035640287 8:1179496-1179518 CCCAGCAGCCAGGTGCCTGTGGG - Intergenic
1036827884 8:11992772-11992794 CCCAGCAGCCATGTGTGGTTGGG + Intergenic
1042224370 8:66504074-66504096 CCCAGCAGCCAGATGGATGTAGG - Intronic
1045394996 8:101751627-101751649 CCCAGCAGCCACATGTCACTGGG + Intronic
1049419363 8:142510238-142510260 CCCAGCCGCCCGCTGTCTACGGG - Intronic
1055289935 9:74771991-74772013 CCCAGCTCCCAGTTGTTTATTGG - Intronic
1055351055 9:75388852-75388874 CCCAGAAGGCAGGTGTCTGTGGG + Intergenic
1056424789 9:86465480-86465502 CCCACCAGCCTGGTGTCTCTGGG + Intergenic
1058061760 9:100504694-100504716 CCCACCAACCATGTGACTATGGG - Intronic
1059468345 9:114483948-114483970 CCCAGAAGTCAGGTGCCCATAGG - Intronic
1060523765 9:124309071-124309093 CCCAGGAGCCTGGTGTCTCAAGG + Intronic
1060762933 9:126271319-126271341 CTCAGGAGCCAGCTGTCTATGGG - Intergenic
1188665765 X:32818898-32818920 CCTAGCTGCAAGTTGTCTATGGG + Intronic
1190319525 X:49172018-49172040 CCCAGCAGCCAGGAGCCGAGAGG - Exonic
1192939349 X:75896478-75896500 CCCAGCAGCCAGGCACCTATTGG - Intergenic
1193707254 X:84836847-84836869 CCAAGGGGACAGGTGTCTATGGG + Intergenic
1198790705 X:140342565-140342587 GAAAGCAGCCAGGTGCCTATGGG + Intergenic
1200763832 Y:7063761-7063783 CCCAGCAGCCAGGGGGCCACGGG - Intronic
1200870209 Y:8089630-8089652 ACCAGCAGCCAGGTGTTATTCGG - Intergenic