ID: 1122348456

View in Genome Browser
Species Human (GRCh38)
Location 14:101074451-101074473
Sequence CGGAGCTACAGGTCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122348450_1122348456 2 Left 1122348450 14:101074426-101074448 CCAAAATCGTTCACACTCTGGTC No data
Right 1122348456 14:101074451-101074473 CGGAGCTACAGGTCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122348456 Original CRISPR CGGAGCTACAGGTCACAAGC TGG Intergenic
No off target data available for this crispr