ID: 1122348666

View in Genome Browser
Species Human (GRCh38)
Location 14:101075575-101075597
Sequence GGCCACACCCCCTCTTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122348659_1122348666 2 Left 1122348659 14:101075550-101075572 CCCCTGGTTTGGGGACTGTTCGG No data
Right 1122348666 14:101075575-101075597 GGCCACACCCCCTCTTTGGTGGG No data
1122348662_1122348666 0 Left 1122348662 14:101075552-101075574 CCTGGTTTGGGGACTGTTCGGCT No data
Right 1122348666 14:101075575-101075597 GGCCACACCCCCTCTTTGGTGGG No data
1122348661_1122348666 1 Left 1122348661 14:101075551-101075573 CCCTGGTTTGGGGACTGTTCGGC No data
Right 1122348666 14:101075575-101075597 GGCCACACCCCCTCTTTGGTGGG No data
1122348658_1122348666 5 Left 1122348658 14:101075547-101075569 CCACCCCTGGTTTGGGGACTGTT No data
Right 1122348666 14:101075575-101075597 GGCCACACCCCCTCTTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122348666 Original CRISPR GGCCACACCCCCTCTTTGGT GGG Intergenic
No off target data available for this crispr