ID: 1122352370

View in Genome Browser
Species Human (GRCh38)
Location 14:101103555-101103577
Sequence GCGCCTCGGGTGGGCTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122352370_1122352381 10 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352381 14:101103588-101103610 TGGCCAGCTCAGGCTGTGTGTGG No data
1122352370_1122352375 -10 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352375 14:101103568-101103590 CCCGAGGCGCTCCCTGCCTCTGG No data
1122352370_1122352385 19 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352385 14:101103597-101103619 CAGGCTGTGTGTGGGGCATGTGG No data
1122352370_1122352382 11 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352382 14:101103589-101103611 GGCCAGCTCAGGCTGTGTGTGGG No data
1122352370_1122352383 12 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352383 14:101103590-101103612 GCCAGCTCAGGCTGTGTGTGGGG No data
1122352370_1122352377 0 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352377 14:101103578-101103600 TCCCTGCCTCTGGCCAGCTCAGG No data
1122352370_1122352386 23 Left 1122352370 14:101103555-101103577 CCTGTCCAGCCCACCCGAGGCGC No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122352370 Original CRISPR GCGCCTCGGGTGGGCTGGAC AGG (reversed) Intergenic
No off target data available for this crispr