ID: 1122352373

View in Genome Browser
Species Human (GRCh38)
Location 14:101103565-101103587
Sequence GAGGCAGGGAGCGCCTCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122352373_1122352381 0 Left 1122352373 14:101103565-101103587 CCACCCGAGGCGCTCCCTGCCTC No data
Right 1122352381 14:101103588-101103610 TGGCCAGCTCAGGCTGTGTGTGG No data
1122352373_1122352377 -10 Left 1122352373 14:101103565-101103587 CCACCCGAGGCGCTCCCTGCCTC No data
Right 1122352377 14:101103578-101103600 TCCCTGCCTCTGGCCAGCTCAGG No data
1122352373_1122352383 2 Left 1122352373 14:101103565-101103587 CCACCCGAGGCGCTCCCTGCCTC No data
Right 1122352383 14:101103590-101103612 GCCAGCTCAGGCTGTGTGTGGGG No data
1122352373_1122352385 9 Left 1122352373 14:101103565-101103587 CCACCCGAGGCGCTCCCTGCCTC No data
Right 1122352385 14:101103597-101103619 CAGGCTGTGTGTGGGGCATGTGG No data
1122352373_1122352382 1 Left 1122352373 14:101103565-101103587 CCACCCGAGGCGCTCCCTGCCTC No data
Right 1122352382 14:101103589-101103611 GGCCAGCTCAGGCTGTGTGTGGG No data
1122352373_1122352386 13 Left 1122352373 14:101103565-101103587 CCACCCGAGGCGCTCCCTGCCTC No data
Right 1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122352373 Original CRISPR GAGGCAGGGAGCGCCTCGGG TGG (reversed) Intergenic
No off target data available for this crispr